ID: 961648660

View in Genome Browser
Species Human (GRCh38)
Location 3:128406315-128406337
Sequence TCATAGAAGCAGAGGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 861
Summary {0: 1, 1: 18, 2: 60, 3: 160, 4: 622}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961648660 Original CRISPR TCATAGAAGCAGAGGGTAGA AGG Intronic
901750128 1:11401464-11401486 GCATAGGGGCAGAGGGTATATGG - Intergenic
901932950 1:12608617-12608639 TCACAGAATCAAAGGGTAGAAGG + Intronic
902072736 1:13754603-13754625 TAATAAAAGCAGAGAGTGGACGG + Intronic
902803086 1:18842749-18842771 TCATAGAAACATAAAGTAGAAGG + Intronic
902992766 1:20200834-20200856 ACATAGGAGCTGAGGGTCGAAGG + Intergenic
903848201 1:26290830-26290852 TCAGAGATGCAGAGGGTGGGGGG + Intronic
903849857 1:26299580-26299602 GCCTAGAAGCAGAGGGTAATGGG + Intronic
904868904 1:33604075-33604097 TCAGAGAAGCCAAGGGAAGAAGG + Intronic
905110548 1:35591395-35591417 TCACTGGAGCAGAGGGTTGATGG - Intronic
906334900 1:44920570-44920592 TCATGGAAGTAGAGAGTAGAAGG - Intronic
906442744 1:45863406-45863428 TCAAAGCAGCAGATGGGAGAAGG + Intronic
906591240 1:47026046-47026068 TCATGGACACAGAGAGTAGAAGG + Intronic
906623859 1:47308572-47308594 TCATGGACACAGAGAGTAGAAGG + Intronic
906782679 1:48586482-48586504 GCATAGAAGGAGAGGGAACAAGG + Intronic
906864256 1:49399024-49399046 TCATGGATGTAGAGAGTAGAAGG - Intronic
906871293 1:49484562-49484584 TCATGGAGACAGAGAGTAGAAGG + Intronic
906906426 1:49898933-49898955 TCATGGAGACAGAGAGTAGAAGG + Intronic
907114017 1:51952824-51952846 TCACAGAAGCTGAGGAAAGAGGG - Intronic
907865299 1:58393677-58393699 TCATAGAAGTAAAGAATAGATGG + Intronic
908125359 1:61024962-61024984 TCATAGAAGCAGAAGAATGATGG + Intronic
908224688 1:62044292-62044314 TCATAGAAGCAGAGAGTAGTGGG - Intronic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
909154371 1:72052993-72053015 TAATAGAAACAGAGAGTAGTAGG - Intronic
909175496 1:72352760-72352782 TCATAGTAGAAGATAGTAGATGG + Intergenic
909772629 1:79442742-79442764 ACACAGACGCAGAGGGAAGATGG + Intergenic
910030788 1:82720017-82720039 TCATGGAAATAGAGTGTAGAAGG - Intergenic
910475751 1:87604427-87604449 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
910751077 1:90631716-90631738 TCATAGGAGCAGAGCATAGGAGG + Intergenic
911194654 1:94981708-94981730 TTAAAGAAGCAGAGGTTAGAGGG + Exonic
911303914 1:96209612-96209634 TGAGAGAAGCAAAGGCTAGATGG + Intergenic
911698128 1:100916790-100916812 TCATGGAAGCAGAGAGTAGAAGG - Intronic
911828363 1:102517427-102517449 TCATAAAAGTAGGGAGTAGATGG + Intergenic
912102077 1:106221949-106221971 TCATAGAGGTAGAGAATAGACGG + Intergenic
912802408 1:112728398-112728420 TCATGGCAGGAGAGGGAAGAGGG - Intergenic
912866834 1:113265108-113265130 TCATAGAAAGAGATGGTTGAGGG - Intergenic
912918665 1:113843487-113843509 TCATAGAGACAGAAAGTAGAAGG + Intronic
913059431 1:115191349-115191371 TCACAGAAGCAAGGGGTAGCAGG - Intergenic
914320941 1:146558949-146558971 CCATAAAACCAAAGGGTAGAAGG + Intergenic
914719454 1:150277591-150277613 TGATTGAAGGAGAGGGTATATGG + Intronic
915039358 1:152955061-152955083 TCATGGAAGCAGAAAGTAGAAGG + Intergenic
916287033 1:163119183-163119205 TTATAGAATTAGAGAGTAGAAGG + Intronic
916615867 1:166438673-166438695 TCATAGAGATAGAGAGTAGAAGG - Intergenic
916729734 1:167555121-167555143 TCATGGAGACAGAGAGTAGAGGG - Intergenic
917069384 1:171133471-171133493 TCACAGAAGCAAAGAGTAGTAGG + Intergenic
917300059 1:173563882-173563904 TCATGGAGGTAGAGAGTAGAGGG - Intronic
917372582 1:174311454-174311476 TCATGGACACAGAGAGTAGAAGG - Intronic
917826663 1:178829210-178829232 TCATAGAAGCAAAAAGTAGAAGG + Intronic
918167823 1:181967499-181967521 TCATAGAAGTAAAGAGTGGATGG - Intergenic
918604184 1:186401597-186401619 TCATAGAAAGAGAGGGAGGAAGG - Intronic
919452779 1:197790038-197790060 TCATATAAACAGAGAGTAAAAGG - Intergenic
919559814 1:199102510-199102532 TCATAGAAGCAGAAAGTAGAAGG - Intergenic
919693386 1:200547627-200547649 TCATAGAAGCAGAGAGGTGAAGG + Intergenic
920191947 1:204199257-204199279 CCCTAGGAGCAGAGGGGAGAAGG + Exonic
920598228 1:207294538-207294560 TCATAGAGGCATAGGGTAGAAGG - Intergenic
920635077 1:207694453-207694475 TCTTGGAAGCAGAGGGAAAAAGG + Exonic
921098546 1:211908655-211908677 TCATAGAAACAGAGAGCAGAGGG - Intergenic
921158964 1:212459596-212459618 TCATAGAAGCAGAGAATAGAAGG - Intergenic
921241613 1:213189830-213189852 TCATGGAGACAGAGAGTAGAAGG - Intronic
921457257 1:215387013-215387035 TCATAGACACAGAGGATAGAAGG + Intergenic
922969494 1:229724074-229724096 TCATAGAGACAGAAAGTAGAAGG + Intergenic
923086656 1:230707786-230707808 TCAGACGAGCAGAGGGAAGACGG - Intronic
923258395 1:232242654-232242676 TCATGGAGGTAGAGAGTAGAAGG + Intergenic
923796981 1:237166238-237166260 TCAGAGAAGCAGATGGAAGTTGG - Intronic
924039376 1:239969099-239969121 TCAAAGAAACAGAGAGTAGAAGG + Intergenic
924450802 1:244177239-244177261 TCATAGAAACAGAGAGTAGGAGG - Intergenic
924515570 1:244762635-244762657 TCATGGAGATAGAGGGTAGAAGG - Intergenic
924537131 1:244945308-244945330 TCATAGAAACAGAAAGTGGAAGG + Intergenic
924551127 1:245078629-245078651 TCATGGAAACAGAGAGTAGATGG + Intronic
1062788401 10:284551-284573 TCATAGAAGCGGAGGGTAAACGG + Intronic
1062963454 10:1590704-1590726 TCATAGAAACAGAGAGCAGAAGG + Intronic
1063441069 10:6073642-6073664 TCACAGAAGTAGAAAGTAGAAGG - Intergenic
1063501217 10:6556492-6556514 TCATAGAGACAAAGAGTAGAAGG + Intronic
1063716953 10:8537351-8537373 TCAGAAGAGCAGAGGGTAAAAGG - Intergenic
1063783901 10:9358098-9358120 TCATAGAAGTAGAAGAGAGATGG - Intergenic
1064319412 10:14288809-14288831 TCATAGAAACAGAGAGTAGAAGG - Intronic
1064419193 10:15175929-15175951 TCATAGAGACAGAGAGTAGAAGG + Intergenic
1064956551 10:20917420-20917442 CAACAGAAGCAAAGGGTAGAAGG + Intronic
1065508535 10:26454530-26454552 TCATGGAGGTAGAGAGTAGAAGG + Intronic
1065876927 10:30005220-30005242 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1065878577 10:30019574-30019596 TCACAGTAACAGAGAGTAGAAGG + Intronic
1066649554 10:37641585-37641607 TCATGGAGGTAGAGAGTAGAAGG - Intergenic
1067795852 10:49321248-49321270 TCATAGAAGCAGAGTAGAGTGGG - Intronic
1067977078 10:51038509-51038531 TCATGGAGATAGAGGGTAGAAGG - Intronic
1068032283 10:51718734-51718756 CCATAGAGACAGAGAGTAGAAGG + Intronic
1068080904 10:52315645-52315667 TTAAGGCAGCAGAGGGTAGAGGG - Intronic
1068164401 10:53309512-53309534 TCATAGAAGCAGATTGTGAATGG + Intergenic
1068725987 10:60304067-60304089 CTATAGAAACAGAGAGTAGAAGG + Intronic
1069312633 10:67057451-67057473 ACACAGAAGCAGAGAGTAGAAGG - Intronic
1069360023 10:67631925-67631947 TCAAAGAAGCAGAGGGTAAAAGG + Intronic
1070568865 10:77625545-77625567 TCATAGAAACAGAAAGTAGAAGG - Intronic
1071461204 10:85897912-85897934 TTATAGAAGCAGAGAGAAGAAGG - Intronic
1071808082 10:89146125-89146147 TGAAAGAAGCAAAGGGTACATGG - Intergenic
1071879402 10:89878723-89878745 TCATAGAGATAGAGAGTAGAAGG - Intergenic
1072250011 10:93574167-93574189 TCATAGAAGCACATGGTTTAGGG + Intronic
1072305903 10:94106982-94107004 CCAAGGAAGCAGAGGGGAGAGGG - Intronic
1073502662 10:103955519-103955541 TCATGGAACTTGAGGGTAGAAGG + Intergenic
1073584540 10:104696937-104696959 TCATAGAAGCAGGGAGTACCAGG + Intronic
1073707138 10:105997666-105997688 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1074493266 10:113957553-113957575 TCATAGAAACAGAAGCTAGAAGG - Intergenic
1075562114 10:123475441-123475463 CCATAGAAGCAGAAGGCATATGG - Intergenic
1075697431 10:124447429-124447451 TCATAGACGCGGGGCGTAGAAGG + Exonic
1075809022 10:125210773-125210795 TCATAGAGACAGAAAGTAGAAGG - Intergenic
1076106457 10:127827407-127827429 CCAGAGAGGCTGAGGGTAGAGGG + Intergenic
1076285613 10:129293258-129293280 TCATAGAAATAGAGAGTAGAAGG + Intergenic
1076672087 10:132127909-132127931 TCATAGGAGAAGTGGGTAAATGG - Intronic
1077449379 11:2627484-2627506 TCAGAGAAACGGAGAGTAGAAGG - Intronic
1077450589 11:2640861-2640883 TCATGGAGGTAGAGAGTAGAAGG - Intronic
1077621925 11:3733196-3733218 TCATAGTTGCAAAGGGAAGAGGG - Intronic
1078121436 11:8513995-8514017 TCATGGAGATAGAGGGTAGAAGG - Intronic
1078124210 11:8543557-8543579 TCATAGATGTAGAAAGTAGAAGG + Intronic
1078312155 11:10255048-10255070 TCACAGAAGCAGAGGGTGAATGG + Intronic
1078548060 11:12260694-12260716 TTTTAGAAGAAGAGAGTAGAAGG + Intronic
1078970548 11:16405726-16405748 TTAAAGAGGCAGAGGGGAGAGGG - Intronic
1079085740 11:17443511-17443533 TCATGCAAGCAGAGGGTTGCTGG + Intronic
1079548047 11:21659114-21659136 TCATAGAAGTAGAGAGTAAGTGG + Intergenic
1080103760 11:28490032-28490054 GAATAGAAGGAGAGGGAAGAAGG + Intergenic
1080289215 11:30652239-30652261 TAATAGAAGGTGAGGCTAGAGGG + Intergenic
1080431665 11:32205232-32205254 TCATAGGAGCAGAGGTTCTAGGG - Intergenic
1080808288 11:35676601-35676623 TTATAGAAGCAGAGGGGAGGTGG + Intronic
1080986373 11:37471557-37471579 TCACAGAAGCAGAAAGTATAAGG + Intergenic
1082716612 11:56621572-56621594 TCATAGAAACAGAGAATAGAAGG + Intergenic
1083188501 11:61032670-61032692 TCATAGAGACAGAAAGTAGAAGG + Intergenic
1084095355 11:66907688-66907710 TTAGAAGAGCAGAGGGTAGAAGG - Intronic
1084335184 11:68453350-68453372 TCATAGAGATAGAGAGTAGAAGG + Intergenic
1084794480 11:71496038-71496060 TCAGAGAAGAAGAGGGCCGAGGG - Intronic
1084826033 11:71732260-71732282 TCATAGAGACACAGGGAAGAAGG - Intergenic
1085256806 11:75178801-75178823 TCATAGAAGCAAAAAGCAGAAGG - Intronic
1085520512 11:77136487-77136509 TCAGAGAATCAGAGGAGAGAGGG - Intronic
1085706745 11:78793249-78793271 TGATACAAGTAGGGGGTAGAAGG + Intronic
1086033527 11:82388791-82388813 TCATAGAGATAGAGAGTAGAAGG + Intergenic
1086875574 11:92091561-92091583 TCATAGAAATAAAGAGTAGAAGG - Intergenic
1087494015 11:98865992-98866014 TCATGGAAGTAGAGAGTGGAAGG + Intergenic
1089029323 11:115307826-115307848 TCATAGAAGGAAAGGATATAAGG - Intronic
1089522863 11:119077228-119077250 TCATAAAACAAGAGGGGAGATGG - Intronic
1089524487 11:119088036-119088058 CCAGAGAAGCAGAGACTAGAGGG - Intronic
1089946832 11:122484039-122484061 TCATGGACGTAGAGAGTAGAAGG + Intergenic
1090118858 11:124003234-124003256 TCATGGACACAGAGAGTAGAAGG - Intergenic
1090676353 11:129000806-129000828 TCATGGAGACAGAGAGTAGAAGG - Intronic
1090691447 11:129187327-129187349 TCATGGACACAGAGAGTAGAAGG + Intronic
1091547442 12:1511193-1511215 TCATAGAAACAGAGAGTCGCAGG - Intergenic
1092140187 12:6178415-6178437 TGATACAAGCAGAGGGAATAGGG - Intergenic
1092632721 12:10400491-10400513 TCATAGAAGCAGGGAGTAGAAGG + Intronic
1092859286 12:12706037-12706059 TAGTCTAAGCAGAGGGTAGATGG - Intergenic
1093210494 12:16302438-16302460 TCATAGAAGTAGAGAGTGGGAGG + Intergenic
1093407803 12:18826345-18826367 ACATAGAAGCAGAGAGTAGCAGG - Intergenic
1094369497 12:29722004-29722026 ATATAGAAGCAGATAGTAGAAGG - Intronic
1095692255 12:45103438-45103460 TCATAGAAAAAGAGGGGAGTTGG - Intergenic
1095736031 12:45557172-45557194 TCATAGAAGCAAAGAGAAGTTGG + Intergenic
1095815305 12:46415497-46415519 TCATGGAAACAGAGAGCAGAAGG - Intergenic
1096262931 12:50104213-50104235 TCATAGCAGCACAGGACAGACGG + Intronic
1096410053 12:51370648-51370670 TCATAGAGACAGAAAGTAGAAGG + Intronic
1096559527 12:52425573-52425595 TCACAGAAACAGAGAGTGGAGGG + Intronic
1096930562 12:55204110-55204132 TCATAGAGATAGAGAGTAGAAGG + Intergenic
1096949476 12:55451341-55451363 TCATAGACATAGAGAGTAGAAGG - Intergenic
1097338052 12:58406745-58406767 GCATAAAAGCAGAGGCTAGAGGG + Intergenic
1097631311 12:62066486-62066508 TCATTGAAATAGAGAGTAGAAGG - Intronic
1097894361 12:64809727-64809749 TCACAGATGCAGAGGGAAGCTGG - Intronic
1098777453 12:74638851-74638873 TCACAGAAGTAGAGATTAGAAGG + Intergenic
1099426131 12:82524876-82524898 TGATATAAGCAGCGGGCAGATGG + Intergenic
1099511322 12:83542505-83542527 TCATTGAAGCAGAGCATAGTGGG + Intergenic
1101361696 12:104033456-104033478 TTACAGAAACAGAGAGTAGAAGG + Intronic
1101363945 12:104054201-104054223 TCATAGAAGCAGGGAGTAGGTGG - Intronic
1102450769 12:113040410-113040432 TCATAGATGCAGAGAGTAGAAGG - Intergenic
1103169764 12:118806667-118806689 TCATAGACATAGAGAGTAGAAGG - Intergenic
1103235117 12:119366122-119366144 TCAAACAACCACAGGGTAGATGG + Intronic
1104094516 12:125544761-125544783 TCAGAGGAGCAGTGGGTATAGGG + Intronic
1104187467 12:126446551-126446573 TCATAGAAGCAGAGAGTATAAGG + Intergenic
1104369991 12:128215947-128215969 TGATAGAAGCAGAGGTGGGAGGG + Intergenic
1104452738 12:128884353-128884375 TCATAGAAGCAGAGAGTAGTAGG + Intronic
1104592374 12:130094885-130094907 TCATAGAGACAGAGAGTAGGAGG + Intergenic
1105515774 13:21089635-21089657 TTGTAGAAGTGGAGGGTAGAGGG + Intergenic
1105583007 13:21718544-21718566 TCATAGAAGCAGAGTAGAAAGGG + Intergenic
1106702429 13:32244500-32244522 TCAGAGAAGGAGAGGGGACAAGG + Intronic
1106890245 13:34237049-34237071 TCATAGAATCAGAGAGTAAATGG - Intergenic
1107737082 13:43410814-43410836 TCAAAGTAGGTGAGGGTAGATGG - Intronic
1108123222 13:47212458-47212480 GGATAGAAACAGAGGGAAGAAGG + Intergenic
1108444074 13:50488762-50488784 TCATAGAAGCAGAGAATAGAAGG - Intronic
1109489570 13:63078206-63078228 TCATTGAAGTAGAAAGTAGATGG - Intergenic
1110003367 13:70233996-70234018 TCATAGAAGTAGAGAGAATATGG + Intergenic
1110378117 13:74817034-74817056 TCATGGACACAGAGAGTAGAAGG + Intergenic
1110514348 13:76392237-76392259 AAATATAAGCAGAGAGTAGAAGG + Intergenic
1110747878 13:79077630-79077652 TCATAGAAACAGAGAGTAGAAGG + Intergenic
1110755669 13:79171338-79171360 GCAGAGAATCAGAGGGTAGGAGG - Intergenic
1110780915 13:79463648-79463670 TCATAGAGACAGAAAGTAGAAGG - Intergenic
1110848129 13:80213050-80213072 TCATAGAAACAGAGAATAGAAGG + Intergenic
1110980640 13:81892337-81892359 TCATGGACACAGAGAGTAGAAGG + Intergenic
1111233964 13:85383741-85383763 TCACAGAGGGAGAAGGTAGAGGG - Intergenic
1111364761 13:87227945-87227967 TCATGGAAACAGAGAGTAGAAGG - Intergenic
1111784332 13:92768433-92768455 TCAAAGGAGCACAGTGTAGAAGG - Intronic
1112023073 13:95388569-95388591 TCATAGAGACAGAAAGTAGAAGG - Intergenic
1112683357 13:101793202-101793224 TCATGAAAACAGAGGGTAGATGG - Intronic
1112971223 13:105265685-105265707 TCATAGAGACAGAAAGTAGAAGG + Intergenic
1113486696 13:110658327-110658349 TCATAGAAACAGAAAGTAGAAGG + Intronic
1113630889 13:111883009-111883031 TCATAAATGCAGAGAGGAGAGGG - Intergenic
1113837124 13:113335649-113335671 TCATGGAGGCAGAGAGTAGAAGG - Intronic
1114067397 14:19073889-19073911 TCATGGACGTAGAGAGTAGAAGG - Intergenic
1115742146 14:36399630-36399652 TGGTAGAAGGAGAGGGAAGAAGG - Intergenic
1116081870 14:40184926-40184948 TCATAGAAGCAGAGAGTAGAGGG - Intergenic
1116157367 14:41223176-41223198 TCATGGACATAGAGGGTAGAAGG - Intergenic
1116264998 14:42676668-42676690 TCATAGAGATAGAGAGTAGAAGG + Intergenic
1116286413 14:42978248-42978270 TCATAGAAGTAGAGAGTAGAAGG - Intergenic
1116287521 14:42991557-42991579 CCAGAAAAGCAGAGGTTAGACGG + Intergenic
1116344024 14:43766330-43766352 TTATAGAAGTGGAGAGTAGATGG - Intergenic
1116458378 14:45144352-45144374 TCATAGAGATAGAGAGTAGAAGG - Intronic
1116683962 14:48013989-48014011 GTATAGAAGCAGAGAGTAGAAGG + Intergenic
1116753922 14:48922037-48922059 TAATAGAAGTAGAAGGGAGAAGG - Intergenic
1117190671 14:53287817-53287839 TCATAGAGGCAGAAAGTAGAAGG - Intergenic
1117461485 14:55949478-55949500 TCATAGAAACAGATAATAGAAGG - Intergenic
1117567800 14:57013621-57013643 TCATGGACACAGAGAGTAGAAGG - Intergenic
1117765414 14:59076818-59076840 TCATTGACACAGAGAGTAGAAGG - Intergenic
1118103290 14:62629582-62629604 TCATAGAAGACGAGAGTCGAAGG - Intergenic
1118147527 14:63156792-63156814 TTGTAGAAACAGAGAGTAGAAGG - Intergenic
1118378408 14:65197373-65197395 TCATGGAAATAGAGAGTAGAAGG - Intergenic
1118788029 14:69062957-69062979 TCATAGAAACTGAGGGCAAATGG - Intronic
1118908323 14:70040061-70040083 TCATAGACACAGAGTGTAGAAGG + Intergenic
1119462946 14:74825957-74825979 TCTGAGAAGCAAATGGTAGACGG - Intronic
1120870649 14:89334205-89334227 TCACAGAAACAGAGAATAGAAGG + Intronic
1120918519 14:89731592-89731614 TCATAGAAACAGAAAGTAGAAGG - Intergenic
1120997260 14:90426260-90426282 TCCCAGAAGCAGAGGGCAGCGGG - Intergenic
1121017448 14:90557124-90557146 AGGTAGAAGCAGAGGGCAGATGG - Intronic
1121377297 14:93424671-93424693 TCATAGAGATAGAGAGTAGAAGG + Intronic
1121597610 14:95177660-95177682 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1121619838 14:95338456-95338478 TCATGGAAACACAGGGCAGAGGG + Intergenic
1121800544 14:96770516-96770538 TAATAGAGGCAGAGATTAGAGGG + Intergenic
1122647543 14:103205421-103205443 TCAAAGAAGCAGAGGCTCAAAGG - Intergenic
1202917314 14_GL000194v1_random:188231-188253 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1123849143 15:24336077-24336099 TCATGGATACAGAGAGTAGAAGG - Intergenic
1124153338 15:27202076-27202098 AGATAGAAGCAGAGAGGAGATGG - Intronic
1124424045 15:29548030-29548052 TCATAGAAACAGAAAGTAGAAGG + Intronic
1125006619 15:34824202-34824224 ACATTGAAGAAGAGGGCAGAGGG + Intergenic
1125170963 15:36766095-36766117 TCATAGAAGCAGAGAGCAGCTGG - Intronic
1125401283 15:39306190-39306212 TCATGGAAGTAGAGAGTACAGGG - Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1125615480 15:41008387-41008409 TCATAAAAGTAGAGAGTAGAAGG + Intronic
1126131935 15:45350079-45350101 TCAGAGAAGCAGAGAATAGCTGG + Intergenic
1126216712 15:46163876-46163898 TCATAGACATAGAGAGTAGAAGG + Intergenic
1126220912 15:46211815-46211837 TCATAGAAACAGAAAGTAGTTGG - Intergenic
1126281234 15:46952553-46952575 TCATTGACACAGAGAGTAGAAGG + Intergenic
1126392541 15:48175271-48175293 ACTCAGAAGCAGAGAGTAGAAGG + Intronic
1126450841 15:48807127-48807149 TCTGAGAAGCAGAGGCTGGAGGG - Intronic
1127018830 15:54722043-54722065 TCATGGCAATAGAGGGTAGAAGG - Intergenic
1127351730 15:58159691-58159713 TCATGAAGGCAGAGAGTAGATGG - Intronic
1127505240 15:59591662-59591684 CCAAAAAAGCAGAGGCTAGAAGG - Intergenic
1127638418 15:60892979-60893001 TCACAGAAGCAGAGGGCAATGGG - Intronic
1127837533 15:62802146-62802168 TCATGGAGATAGAGGGTAGAAGG - Intronic
1128079969 15:64851129-64851151 TCAGAGAAGCAGTGGGAAGAGGG + Intronic
1128355140 15:66921074-66921096 CCAGAGACGCAGAGGGAAGATGG + Intergenic
1128692697 15:69737329-69737351 TTTTAGAAGCAGAGATTAGAGGG + Intergenic
1129014941 15:72458481-72458503 TCAGAGAAAGAGAGGGTAGGTGG + Intergenic
1129095511 15:73202811-73202833 TCATAGAAATAGAAGGTAAAAGG - Intronic
1130819764 15:87482372-87482394 TCATGGACACAGAGAGTAGAAGG + Intergenic
1131125015 15:89852601-89852623 TGATAGAATCCCAGGGTAGAGGG - Intronic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1131919409 15:97307379-97307401 TCATAGAAACAGAGAGCAGAAGG - Intergenic
1131925444 15:97378287-97378309 ACATAGAAGCAGAAGATAGAAGG + Intergenic
1132666990 16:1085751-1085773 TCATAGAGACAGAAAGTAGAAGG - Intergenic
1132941089 16:2508694-2508716 TCCTAGAAGCAGGGGGGACAAGG - Intronic
1133302812 16:4793169-4793191 GCCTGGAAGCAGAGGGTGGAGGG + Intronic
1133384617 16:5358991-5359013 TCATGGAAACAGAGAGTAGAAGG - Intergenic
1133465480 16:6023008-6023030 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1133493377 16:6293655-6293677 TCATAGAAACATAGGGAAGAGGG + Intronic
1133626576 16:7575508-7575530 ACATTGAAGCAGAGGATGGAAGG + Intronic
1133699240 16:8293805-8293827 TCATGGAGATAGAGGGTAGAAGG + Intergenic
1134027439 16:10965069-10965091 TCATAGAAGCAGAGAGTCAAAGG - Intronic
1134235717 16:12464041-12464063 TCATAGAAGCAGAGAACAGACGG - Intronic
1134305280 16:13026259-13026281 TCAAAGAAACAGAAAGTAGAAGG - Intronic
1134817781 16:17220397-17220419 TGAGAGAAGCAGTGGGTAGCCGG + Intronic
1135609155 16:23850002-23850024 TCATAGAAGTAGAGAGTAGGAGG - Intronic
1135928930 16:26720134-26720156 TCATAGAAGCAGAGAGTAGAAGG + Intergenic
1136369200 16:29825497-29825519 CCATAGATGGCGAGGGTAGAAGG + Intronic
1137819662 16:51431885-51431907 TCATAGAAAAAGAGGAAAGAAGG + Intergenic
1137851178 16:51745423-51745445 TCATGGAGATAGAGGGTAGACGG + Intergenic
1138133880 16:54504741-54504763 TCCTACAAGCAGATGTTAGAAGG + Intergenic
1138391048 16:56670072-56670094 ACATAGAGGCACAGGGAAGAGGG - Intronic
1138639091 16:58368583-58368605 TTATAGAGGCAGAGAGGAGATGG - Intronic
1139181281 16:64751436-64751458 TCATAGAAGTAGAGAATAGAAGG - Intergenic
1140012592 16:71151158-71151180 CCATATAACCAAAGGGTAGAAGG - Intronic
1140376633 16:74450170-74450192 TAATAGAAGTAGAGGGTAGGGGG - Intergenic
1140449780 16:75061333-75061355 TCATGGACACAGAGGGTAGAAGG - Intronic
1140796393 16:78442481-78442503 TCACAGAAGCAGAGAGTAGAGGG - Intronic
1141058261 16:80839154-80839176 TCATAGAAGTAGAGAGTAGAAGG - Intergenic
1141278768 16:82611744-82611766 TCATAGAAGCAGAGAGTAGAAGG + Intergenic
1141625859 16:85260758-85260780 ACAGGGAAGCAGAGAGTAGATGG - Intergenic
1141710081 16:85693522-85693544 TCATAGAAGTAGATAGTAGCAGG - Intronic
1143415547 17:6746371-6746393 TTATAGAGACAGAGAGTAGAAGG + Intergenic
1143430787 17:6881625-6881647 TCATAGACGTAGAGAGTAGAAGG - Intronic
1143910126 17:10241573-10241595 TCATAGAGACAGAAAGTAGAGGG - Intergenic
1146431510 17:32800503-32800525 TAATAGAAGTAGAGAGTAGATGG + Intronic
1146745502 17:35325062-35325084 TCATAGAGATAGAGAGTAGAAGG + Intergenic
1147335324 17:39724017-39724039 TCCTAGCAGGAGAGGGTGGAGGG - Intronic
1147490297 17:40859769-40859791 TCAAAGAAGCAGAAGGGAGAGGG - Intergenic
1148994601 17:51698744-51698766 TCACAGAAGCAGAGAGTAGGTGG - Intronic
1149241124 17:54650895-54650917 TCATAGAAATAGAGAGTAGAAGG - Intergenic
1149916973 17:60619071-60619093 TCACAGAAGGAAAGAGTAGAAGG - Intronic
1151128865 17:71875186-71875208 TCATGGAGATAGAGGGTAGAAGG + Intergenic
1151886355 17:76925319-76925341 TCAAAGCAGCAGAGGGGTGATGG - Intronic
1153419702 18:4891627-4891649 TCATAAAAGCAGAGAGTAAGAGG + Intergenic
1153958626 18:10121240-10121262 TCACAGAAGCAGAGAGCAGAAGG + Intergenic
1154041627 18:10861558-10861580 TGATAGAAGTAGAGAGTAGAGGG + Intronic
1154408607 18:14121135-14121157 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1155047580 18:22116295-22116317 TCATAGATGCAGAGGAAAGGTGG + Intergenic
1156024314 18:32634330-32634352 TCATTGAAGGAGTGGGTACATGG + Intergenic
1156156356 18:34307393-34307415 TCATAGAGACAGAATGTAGAAGG + Intergenic
1156322047 18:36035889-36035911 TCATAGAAAAAAAGAGTAGAAGG + Intronic
1156534572 18:37850172-37850194 ACAAAGAGGGAGAGGGTAGAAGG - Intergenic
1156708752 18:39915788-39915810 TGATAGTAGCAGTAGGTAGATGG + Intergenic
1156919782 18:42507506-42507528 TCCTGGAAGTAGAAGGTAGATGG + Intergenic
1157851827 18:51061384-51061406 CCATAGAGACAGAGAGTAGAAGG - Intronic
1158204726 18:54980133-54980155 TTACAGAAGCAGAGGCTTGAAGG - Intergenic
1158908718 18:62039111-62039133 ACAGAGAAGCAGAGGATTGAAGG - Intergenic
1159451325 18:68605788-68605810 TCATAGAAGCAGAGAGGAGAAGG - Intergenic
1159595479 18:70378771-70378793 TCATAGAAGCAGAGGGAAAGGGG - Intergenic
1159846456 18:73466904-73466926 TCATAGAAGCAAAGAGTAGAAGG + Intergenic
1160079683 18:75713711-75713733 TCATAGAAGCTGATTGGAGAAGG + Intergenic
1160363094 18:78300949-78300971 TCATAGTCTCAGAAGGTAGAAGG - Intergenic
1160471586 18:79139852-79139874 TCATGGAGACAGAGAGTAGAAGG - Intronic
1161496399 19:4588559-4588581 TCATAGAGACAGAAAGTAGATGG + Intergenic
1162614856 19:11790954-11790976 TCATAGAGATAGAGAGTAGAAGG + Intergenic
1163201997 19:15776316-15776338 TCACAGAAGCCTAGGGGAGAAGG + Intergenic
1163881558 19:19927508-19927530 TCATAAAAACAGAAAGTAGAAGG - Intronic
1163971377 19:20798713-20798735 TCATAAAATCAGAAAGTAGAAGG - Intronic
1164253036 19:23500882-23500904 TCATAAAAACAGAGTGTGGAAGG + Intergenic
1164278727 19:23749287-23749309 TCATAAAAACAGAAAGTAGAAGG + Intronic
1164317903 19:24110719-24110741 TCATAAAAACAGAAGGTGGAAGG - Intronic
1164782113 19:30901216-30901238 TCCTAGGGGCAGAGGGTAGAGGG - Intergenic
1165085801 19:33346148-33346170 TCAGAGAAGCAGGGGGCAGGGGG + Intergenic
1165263788 19:34643374-34643396 TCATAAAGGTAGAGAGTAGAAGG + Intronic
1165280190 19:34790571-34790593 TCATAGAAGTAGAGAGCGGAAGG + Intergenic
1165561010 19:36679781-36679803 TCTTAGAAGTAGAGAGTAGGAGG + Intergenic
1165613607 19:37178972-37178994 TCACTGAAGCTGAGGGTGGAGGG + Intronic
1165638726 19:37365678-37365700 TCAAAGAAGCAAAGGCTTGAAGG - Intronic
1166762194 19:45231945-45231967 TCACAGAAACAGTGGGTAGGAGG - Intronic
1167197004 19:48036473-48036495 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1168081169 19:54011727-54011749 TCATAGAGACAGAAAGTAGAAGG - Intronic
1168178004 19:54638842-54638864 TCATGGAAGTAGAGAGTAGAAGG - Intronic
924994855 2:350142-350164 TCAGAGAAGCAGAGAGTGGAAGG - Intergenic
924997891 2:380762-380784 TCATAAAAATAGAGAGTAGACGG + Intergenic
925119858 2:1409898-1409920 TCATGGAAGCAGAGAGTGGATGG + Intronic
925273669 2:2633854-2633876 TCACAGAAGCAGAGAGTAGATGG - Intergenic
925488348 2:4362544-4362566 TCTTAGAAGCAGAGAGTAGATGG - Intergenic
925518296 2:4709572-4709594 ACTCAGAAGCAGAGAGTAGAGGG + Intergenic
925559082 2:5168392-5168414 TCACACCAGCAGAGGGTACATGG + Intergenic
925800545 2:7595191-7595213 GCATATAAGCACAAGGTAGAGGG + Intergenic
925897739 2:8486365-8486387 TCACAGAAGCAGAGTGTGAATGG - Intergenic
926852022 2:17209295-17209317 TCATAGAAACAGAGATTAGAAGG - Intergenic
927466129 2:23338062-23338084 TCATAGAAGTAGAGAGCAGAAGG + Intergenic
927542233 2:23923315-23923337 TCACAGAAGCAGAGAGTAGAAGG + Intronic
927639222 2:24836280-24836302 CCGTAGAACAAGAGGGTAGATGG - Intronic
928276153 2:29901929-29901951 TCAGGGAAGCAGAGGGGAGGGGG + Intronic
928475200 2:31618631-31618653 TCATAAAAACAGAGAGTAGAAGG + Intergenic
928488716 2:31758718-31758740 TCTTAGAGACAGAGAGTAGAAGG + Intergenic
928751702 2:34478061-34478083 TTATAGAAGCAGAGGATAATAGG + Intergenic
929068441 2:38004659-38004681 TCATAGAAGGAGAGAGTAGAAGG - Intronic
929394754 2:41510048-41510070 TCACAGAAGCGGAGTATAGAAGG - Intergenic
929877184 2:45806617-45806639 TCATAGAGACAGAAAGTAGAAGG - Intronic
929929414 2:46240569-46240591 TCATAGAGACAGAAAGTAGATGG + Intergenic
930522239 2:52482034-52482056 CCATAGAGGCAGAGGGTAGAAGG + Intergenic
930564472 2:53002167-53002189 TCATGGAGACAGAGAGTAGAAGG - Intergenic
930749738 2:54922850-54922872 TCACAGAAGTAGAGAGTAGAAGG + Intronic
931260038 2:60609815-60609837 TCCAAGAAGCAGATGTTAGAGGG - Intergenic
931630553 2:64294760-64294782 TTGTAGAATCAGTGGGTAGATGG - Intergenic
932048652 2:68376950-68376972 TCATGGACACAGAGAGTAGAAGG - Intronic
932266933 2:70375869-70375891 TCATAGAAACAGAGAGTAGAAGG - Intergenic
932480212 2:72034643-72034665 TCCTAGAAGCTGAGAGTAGGTGG + Intergenic
933113028 2:78428565-78428587 TCATAGAAACAGAGAGTAGACGG + Intergenic
933828577 2:86187241-86187263 TCATAGAAACAGAAAGTACATGG - Intronic
933845287 2:86321176-86321198 TGCTAGAAGAAGAGGGGAGAAGG + Intronic
935422393 2:102883257-102883279 TCATAGTAGCAGAGAGTAGGAGG - Intergenic
935452750 2:103229264-103229286 TTACAGAAGCAGTGAGTAGAAGG + Intergenic
935611395 2:105029585-105029607 TCATAGAGACAGAAAGTAGAAGG + Intergenic
935627372 2:105182412-105182434 TCATAGAGATAGAGAGTAGAAGG - Intergenic
935724809 2:106014233-106014255 GCACAGAAGCAGAGAGTAGAAGG - Intergenic
936135722 2:109891814-109891836 TCATGGACACAGAGAGTAGAAGG - Intergenic
936208975 2:110479671-110479693 TCATGGACACAGAGAGTAGAAGG + Intergenic
937487753 2:122333461-122333483 TCATGGACGTAGAGAGTAGAAGG - Intergenic
937540962 2:122952919-122952941 TCATAGAGGCAGAAAGTAGATGG + Intergenic
937736259 2:125294404-125294426 TCATAGAGATAGAGAGTAGAAGG - Intergenic
938988786 2:136606553-136606575 TAATAGAAACAGAGGGTAGAAGG - Intergenic
939564818 2:143774660-143774682 TCACAGAAGCAGTGGAGAGATGG + Intergenic
939800930 2:146707030-146707052 TCATGGACATAGAGGGTAGAAGG + Intergenic
939948795 2:148443700-148443722 TCATAGAAATAGAAAGTAGAAGG + Intronic
940432934 2:153615056-153615078 TCATGGAGATAGAGGGTAGAAGG - Intergenic
941139369 2:161759512-161759534 TCATATAAGCAGAGTGTAGAAGG - Intronic
941993838 2:171582704-171582726 TCATAGAAGCAGAGAGTAGTTGG - Intergenic
942033135 2:171983692-171983714 TCTTAGAAGCAAAGTGTGGAAGG - Intronic
942479926 2:176374260-176374282 TCATAGAGATAGAGAGTAGAGGG + Intergenic
942629788 2:177942903-177942925 TCATAGAAACAGAAAGTAAAAGG - Intronic
942650327 2:178160173-178160195 TCATAGAAACAGAAAGTAGAAGG - Intergenic
942769629 2:179501540-179501562 TCATGGACACAGAGAGTAGAAGG + Intronic
942787652 2:179718883-179718905 TCATAGAAGCAGACAGCAGAAGG + Intronic
943349187 2:186778263-186778285 TCATAGAAATAAAGAGTAGATGG + Intergenic
943430057 2:187788591-187788613 TCATGGAGACAGAGAGTAGAGGG + Intergenic
943877960 2:193098114-193098136 ATATAGGAGCAGAGAGTAGATGG - Intergenic
944032246 2:195249406-195249428 TCACAGAAGCAGAAAGTAGAAGG + Intergenic
944150830 2:196556465-196556487 TCATAGAAACAGAGAGTAGAAGG - Intronic
944377519 2:199064402-199064424 TCATTGACACAGAGAGTAGAAGG + Intergenic
944727037 2:202482014-202482036 TCATAGAGACAGAAAGTAGAGGG - Intronic
944751098 2:202710743-202710765 TCATGGAGACAGAGAGTAGAAGG - Intronic
944814685 2:203363562-203363584 TCACAGAAATAGAGAGTAGAAGG - Intronic
944958353 2:204838548-204838570 TCAAAGAAGCAGAGGATGGAAGG + Intronic
945477190 2:210297811-210297833 TCATAGAAGCAGTGTGTCAAAGG + Intronic
945757822 2:213871271-213871293 TCATAAAAGCAGAGAGAATATGG + Intronic
945819143 2:214641775-214641797 CCAGAGAAGCAGGTGGTAGATGG - Intergenic
946311493 2:218884551-218884573 TCTGAGAAGTAGAAGGTAGAAGG - Intronic
946336764 2:219042837-219042859 TTACAGAAGCAGAGGCTACAGGG - Intergenic
946530270 2:220563263-220563285 TCAGAGAGGCAGAAAGTAGACGG + Intergenic
947133121 2:226950225-226950247 TCACAGAAGCAGAGAGCAGAAGG - Intronic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
948703436 2:239775045-239775067 ACATAGAAGCAGAGGGAAGGGGG + Intronic
948751779 2:240137207-240137229 TCATAGAGACAGAAAGTAGAAGG + Intergenic
948777054 2:240294679-240294701 TCATAGAGACAGAAAGTAGAAGG - Intergenic
948792601 2:240386680-240386702 TCACAGAGGCAGAGGGCAGACGG + Intergenic
948912831 2:241013266-241013288 TCATAGAAGCAGAGAGTAGAAGG - Intronic
948937300 2:241175369-241175391 TCATAGAGACAGAAAGTAGAAGG - Intronic
1168980064 20:1996466-1996488 TTATAGAGGCAGAGGTTAGGAGG - Intergenic
1169060415 20:2656688-2656710 TGAGTGAAGCTGAGGGTAGAGGG + Intronic
1169295685 20:4395838-4395860 TCATAGAAACAGAGAGTAAAGGG - Intergenic
1169508675 20:6240872-6240894 TCTTGGAATCAGAGAGTAGAAGG - Intergenic
1170040259 20:12032887-12032909 TGAAGGAAGAAGAGGGTAGAAGG + Intergenic
1170608064 20:17888566-17888588 TCATAGAAGCAGATGGTCCCAGG - Intergenic
1170631347 20:18068928-18068950 TCATAGAAGGAGAAAGTAGAAGG - Intergenic
1171131340 20:22656350-22656372 TCATAGAGACAGAGAGTAGAAGG - Intergenic
1171208729 20:23300949-23300971 TCATCGAAACAGTGAGTAGAGGG - Intergenic
1171489312 20:25505277-25505299 TCACAGGAGCAGGGTGTAGAAGG + Intronic
1172022172 20:31922482-31922504 TCATAGAGATAGAAGGTAGATGG - Intronic
1172394167 20:34587678-34587700 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1172700202 20:36848607-36848629 TCAGAGAAGCACAGGGAAGGTGG + Intronic
1173267211 20:41495414-41495436 TCATAGAAGCAGAGAGTAAATGG + Intronic
1173418560 20:42880266-42880288 TCATAGAACCCTAGGGAAGAGGG + Intronic
1173762108 20:45571666-45571688 TTGTAGAAGTAGAGAGTAGATGG - Intronic
1175007285 20:55698520-55698542 TCTTAGATTCAGAGGGTACATGG + Intergenic
1175195150 20:57238147-57238169 TCATAGAGACAGAAAGTAGAAGG - Intronic
1175585480 20:60135987-60136009 TCATGGAGATAGAGGGTAGAAGG + Intergenic
1176636762 21:9252333-9252355 TCATACCTTCAGAGGGTAGAGGG + Intergenic
1176737730 21:10567132-10567154 TCATAGACCTAGAGAGTAGATGG + Intronic
1177105692 21:16952855-16952877 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1177705991 21:24705468-24705490 CCATGGAAGCAGAGTGGAGAGGG + Intergenic
1178095903 21:29215359-29215381 TAATAAATGAAGAGGGTAGATGG - Intronic
1178286275 21:31328045-31328067 GCATCGAGGCAGAGGGCAGAGGG - Intronic
1178895935 21:36556978-36557000 TCACAGAAGCAGAGAGTAGATGG - Intronic
1178935221 21:36856021-36856043 CCATAGAAACAGAAAGTAGATGG + Intronic
1179276087 21:39892999-39893021 TCGTAGACACGGAGGGTAGAAGG + Intronic
1179769301 21:43602632-43602654 TCATCCAGGCACAGGGTAGAGGG - Intronic
1180139288 21:45881747-45881769 TCACAGAAGCAGAGGGTGGGAGG - Intronic
1182206790 22:28635985-28636007 TCATAAAAACAGAGAGTAGAAGG - Intronic
1182677143 22:32048247-32048269 ACACAGAAGAAGAGGGAAGATGG + Intronic
1183359509 22:37376143-37376165 TCAAAGAAGCAGGGGGTTGGTGG + Intronic
1183683492 22:39349082-39349104 TCATGGAAACGGAGGCTAGATGG - Intergenic
1203290440 22_KI270735v1_random:32110-32132 TCATAGATCCAGAGAGAAGAGGG + Intergenic
949159590 3:864414-864436 TTATAGCAGCACAGAGTAGAAGG - Intergenic
949269265 3:2195107-2195129 TCACAGAAGCAGAGAGTATAAGG - Intronic
949698643 3:6729695-6729717 TCATAGAAACAGACAATAGAAGG + Intergenic
950694267 3:14685699-14685721 TCATAGAAGCAGAGAGTGAATGG - Intronic
951085461 3:18507782-18507804 TCATAAAAACAAGGGGTAGAAGG + Intergenic
951177350 3:19617363-19617385 TCATGGACACAGAGAGTAGAAGG - Intergenic
951904886 3:27695351-27695373 TCATGGACACAGAGAGTAGAAGG + Intergenic
952087051 3:29836510-29836532 TCATAGAAACAGAGCACAGAAGG + Intronic
952538364 3:34338264-34338286 TCATAGAACTAGAGAGTAGAAGG + Intergenic
953189631 3:40671851-40671873 GCGTAGAAGCAGAGAGTATATGG + Intergenic
953296854 3:41727486-41727508 TCATTGAAGCAGAGACCAGAAGG + Intronic
953498699 3:43412207-43412229 TCATTGTAGGAGAGGGCAGAGGG - Intronic
955028540 3:55193603-55193625 TCATGGAGACAGAGGGTAGAAGG - Intergenic
955073616 3:55592392-55592414 TCCCAGAAGGAGAGGGCAGAGGG - Intronic
955134485 3:56202742-56202764 TCATAAAAACAGACAGTAGAAGG + Intronic
955607117 3:60717099-60717121 TCATAGAAGCAGGTAGTAGAAGG + Intronic
956456398 3:69424978-69425000 ACATAAAAGCAGAGGGTTGCGGG - Intronic
957103998 3:75862932-75862954 TCATACCTTCAGAGGGTAGAGGG - Intergenic
957145986 3:76424463-76424485 ACATAGAAGCAGAGAGTAGAAGG + Intronic
957284548 3:78201564-78201586 TCATAGAAACAGAGGGCAGAAGG + Intergenic
958635113 3:96733938-96733960 CCAAAATAGCAGAGGGTAGATGG - Intergenic
958637003 3:96757709-96757731 TAATAGAAACAGAGAGTAGAAGG - Intergenic
958930892 3:100206884-100206906 TGTTGGAAGCACAGGGTAGAGGG - Intergenic
959233298 3:103685794-103685816 TCATAAAAACAAAGAGTAGAGGG - Intergenic
959309423 3:104714537-104714559 ACATAGAAACAGAGAGTCGAAGG + Intergenic
959654224 3:108782768-108782790 TCATAGAAACAGAAAGTAGAAGG - Intergenic
959781096 3:110234237-110234259 TAATAGAAACAGAGATTAGAAGG + Intergenic
960141295 3:114154177-114154199 TCATAGAACCAGAAGTCAGAAGG - Intronic
960242106 3:115356532-115356554 TCATAGATATAGAGAGTAGAAGG + Intergenic
960474070 3:118102403-118102425 TCATAGAGGCAGAGAGTAGAAGG - Intergenic
960706376 3:120485970-120485992 TCATAGAAACAAAGAGTAGAAGG - Intergenic
960737347 3:120795143-120795165 TCATTGTAGCAGAGGGAAGGGGG - Intergenic
961025310 3:123550547-123550569 ACAGAGAAGCAGAGGGCAAATGG + Intronic
961597466 3:128029901-128029923 TCACAGAAGCAGAGAGTAGAAGG - Intergenic
961648660 3:128406315-128406337 TCATAGAAGCAGAGGGTAGAAGG + Intronic
962086364 3:132196064-132196086 TCATAGAAGCAGAGGGCAATTGG + Intronic
962256671 3:133875377-133875399 ACATACAAGCACAGGGTAGAAGG + Intronic
962555543 3:136547519-136547541 TCATGGAAGGAGAGAGCAGAAGG - Intronic
962612394 3:137090077-137090099 TCATGGATGTAGAGAGTAGAAGG - Intergenic
963125047 3:141808412-141808434 TCATAGAGACAGAAAGTAGAAGG + Intronic
963929784 3:150991802-150991824 TCTCAGAAGCTGAGGGGAGATGG - Intergenic
964452889 3:156828620-156828642 TCATAAAACCAGAGGATAAATGG - Intronic
965099947 3:164283529-164283551 TCATAGAAGTAGACAATAGAAGG + Intergenic
965605024 3:170489902-170489924 TCATGGACACAGAGAGTAGAAGG + Intronic
965632107 3:170743625-170743647 TCATAGAAGCAGAGAGTAGACGG - Intronic
965861100 3:173151601-173151623 TCATGGACACAGAGAGTAGAAGG + Intergenic
966268106 3:178071097-178071119 AGACAGAAGCAGAGGTTAGAGGG - Intergenic
967411683 3:189172517-189172539 TAATAGAGGAAGAGGGAAGAAGG - Intronic
967789766 3:193534768-193534790 TCCTAGAAGGAGAGGGGAGAGGG + Intronic
967928144 3:194668997-194669019 TCATAGAAGCAGAGAGAAAATGG + Intronic
1202750133 3_GL000221v1_random:152686-152708 TCATACCTTCAGAGGGTAGAGGG - Intergenic
968385967 4:138315-138337 TCATAGAGACAGAGAGCAGAAGG - Intronic
968749326 4:2379067-2379089 TCATGACAGCAGGGGGTAGACGG + Intronic
968961879 4:3749689-3749711 TCATAGAGACAGAGAATAGAAGG - Intergenic
969200853 4:5604506-5604528 TCATGGAGGTAGAGGGTGGAAGG + Intronic
970338426 4:15078767-15078789 TCATAGGGGCAAAGAGTAGAAGG + Intergenic
970972062 4:21996486-21996508 TCATAGAAACAGAAAGTTGAAGG + Intergenic
971032011 4:22648412-22648434 TCATAGAAGCACAGAGTAGAAGG - Intergenic
971041323 4:22755472-22755494 TCAAAGAGGCAGAGAGTAGATGG - Intergenic
971859453 4:32086012-32086034 TGATAGTAGCAGAAGGCAGATGG - Intergenic
972269217 4:37493759-37493781 TCATGGACACAGAGAGTAGAAGG - Intronic
972380142 4:38511887-38511909 TCATAGAAACAGAGGATACAAGG - Intergenic
974097590 4:57381566-57381588 TCATAGGAGCAGAGAGTAGAAGG + Intergenic
974104141 4:57448640-57448662 TCATATAAAGAGAGAGTAGACGG - Intergenic
974111307 4:57528803-57528825 TAATAGAAACAGAGAGTAGAAGG + Intergenic
974163854 4:58174668-58174690 TGATAGCACCAGAGGGTAGGAGG - Intergenic
974498363 4:62663247-62663269 TCATACAGGCAGAGAGTAGAAGG - Intergenic
974632323 4:64509512-64509534 TCATGGAAGTAGAGAGTAGAAGG - Intergenic
974740713 4:66003087-66003109 TAATGGAAGCAGAGAGTAGAAGG - Intergenic
974781048 4:66553190-66553212 TCATGGACCTAGAGGGTAGAAGG + Intergenic
974828161 4:67155536-67155558 TCAAAGAAAAAGAGGATAGAAGG + Intergenic
975081396 4:70284639-70284661 TCATGGACACAGAGAGTAGAAGG + Intergenic
975276801 4:72512075-72512097 TCATAGATGTAGAGAGTAGAAGG + Intronic
975454142 4:74569721-74569743 TAATGGAAGCAGAGAGTAGAAGG + Intergenic
975513688 4:75221398-75221420 TCATAGACACAGAGAGTATAAGG + Intergenic
975649295 4:76576461-76576483 TCATGGACACAGAGAGTAGAAGG + Intronic
975660313 4:76681961-76681983 CCAGAGAAGCAGAGAGTTGAGGG - Intronic
976002699 4:80390304-80390326 TCATAAAAGCAGAGAACAGATGG - Intronic
976072131 4:81253772-81253794 TCATAGAAGCAGAGCTCAGAGGG + Intergenic
976137801 4:81957693-81957715 TCATGAAAGTAGAGAGTAGAAGG + Intronic
976834604 4:89356811-89356833 TCATAGAAGCACCCGGTTGATGG + Intergenic
977236322 4:94511657-94511679 TCATTGACACAGAGAGTAGAAGG - Intronic
978482899 4:109214715-109214737 TTCTGGAAGCACAGGGTAGATGG - Intronic
978684897 4:111428749-111428771 TCATGGAGGTAGAGAGTAGAAGG + Intergenic
978970905 4:114805179-114805201 TCATAGAAGTAGAGAGTGGCAGG + Intergenic
979066258 4:116137687-116137709 TCATATAAGCAGAGAGCAGAAGG - Intergenic
979338497 4:119491613-119491635 TCATAGAAGTACACTGTAGATGG - Intergenic
979471340 4:121101112-121101134 TCATAGAAGCTGAGAGTCCAAGG - Intergenic
979718297 4:123868293-123868315 TCATAGCAACAGAAAGTAGATGG + Intergenic
980044794 4:127975337-127975359 TCATAGAAGCAGAAAGTAGAAGG - Intronic
980339094 4:131518999-131519021 TCATGGACATAGAGGGTAGAAGG - Intergenic
980475081 4:133303657-133303679 TCATAGATGCAAAGAGTAGAAGG - Intergenic
980610646 4:135156899-135156921 TCATAGAAACAGAGAGTAGAAGG + Intergenic
980763858 4:137272715-137272737 TCATGGAAGTAGAGAGTAAATGG + Intergenic
980870387 4:138604618-138604640 TCTCAGAAGCAGAGAGGAGAAGG - Intergenic
980871443 4:138615636-138615658 ACAGAGAAGCAGAGAATAGAAGG + Intergenic
980934082 4:139209711-139209733 TCATAGACGCAGAAAGTAGAGGG - Intergenic
981239244 4:142455342-142455364 TCTTAGACTTAGAGGGTAGAAGG - Intronic
981622460 4:146717921-146717943 TCAAAGAAGCAGAGAGCAGAAGG - Intronic
981680940 4:147397142-147397164 TCATAGAAGTGGAGAGTAAATGG + Intergenic
982102655 4:151983311-151983333 TCAGAGAGGCAGAAGATAGAGGG - Intergenic
982134591 4:152261931-152261953 TCACAGAAACAAAGAGTAGAAGG + Intergenic
982146645 4:152402055-152402077 TCAGTGAAGCAGAGGGGAGTGGG + Intronic
982698913 4:158636929-158636951 TCATGGAAGTAGAGAGTAGAAGG - Intronic
983027187 4:162752743-162752765 TCATAGAACTAGAGAGTAGATGG + Intergenic
983379648 4:166975693-166975715 TCATAGAGATAGAGAGTAGAAGG - Intronic
983662813 4:170147423-170147445 TCCTAGAAACAGAGAGTAGAAGG - Intergenic
984235373 4:177151183-177151205 TCATAGAAGCACAGAGTCAATGG + Intergenic
984264512 4:177481079-177481101 TCATAGAAGTAGAGATTAGAAGG - Intergenic
984496057 4:180498391-180498413 TCATGGAGACAGAGAGTAGAAGG - Intergenic
984855871 4:184195621-184195643 TCACAGAGACAGAGCGTAGAAGG - Intronic
984914173 4:184705911-184705933 TCATAGAAACAGAAAGTAGAAGG + Intronic
985144818 4:186885715-186885737 TTATAGAAGCAGGGAGTACAGGG + Intergenic
985276665 4:188244311-188244333 TCATAGAAACAGGGAGCAGAGGG - Intergenic
1202751650 4_GL000008v2_random:10775-10797 TCATACCTTCAGAGGGTAGAGGG + Intergenic
985950045 5:3216035-3216057 TCATGGAGACAGAGAGTAGAAGG + Intergenic
986058847 5:4168610-4168632 TCACAGAAGCAGAAAGTAAATGG + Intergenic
986645301 5:9910999-9911021 TGAAAGAAGCAGAGGTTGGAGGG - Intergenic
986662162 5:10068970-10068992 TCATAGAAGCTGAGAGTGGAAGG - Intergenic
986957568 5:13172572-13172594 TTATAGAAACAGAGAGTAGGAGG - Intergenic
987653934 5:20781757-20781779 TCATAGAAGCAGATAGTAAAAGG - Intergenic
987887086 5:23826751-23826773 TCATGGACGTAGAGAGTAGAAGG - Intergenic
988207080 5:28152351-28152373 TCATAGAAATGGAGAGTAGAGGG - Intergenic
988741641 5:34079734-34079756 TCATAGAAGCAGAGAGTAAAAGG + Intronic
989330313 5:40250735-40250757 TCATGGAGGTAGAGAGTAGAAGG + Intergenic
989657844 5:43763145-43763167 TCAGAGAAGAAAAGGGGAGATGG - Intergenic
989683304 5:44055145-44055167 TCATGGAAGTAGAGAGTAGAAGG + Intergenic
990532210 5:56685561-56685583 TCATAAAAATAGAAGGTAGAAGG - Intergenic
990886922 5:60605112-60605134 CAATAGAAGCAGAGATTAGATGG + Intronic
990963909 5:61424150-61424172 ACATAGGAGCAGAAGTTAGAAGG + Intronic
991238416 5:64426795-64426817 TCATAGAGACAGAGAGCAGAAGG + Intergenic
991671985 5:69056888-69056910 TCATGGAGGCTGAGAGTAGAAGG - Intergenic
992659843 5:78948093-78948115 TCATAGAGGTAGAGAATAGAAGG + Intronic
992707124 5:79407721-79407743 TCATAGAAGGAGAAGAGAGAAGG + Intronic
993086451 5:83369262-83369284 TCATAGAATCAGAGGGCGCATGG + Intergenic
993093579 5:83457054-83457076 TCATAGAAGCAGAGAATAGAAGG + Intergenic
993230736 5:85231926-85231948 TCATATAAACAGAGAGTACAAGG - Intergenic
993472784 5:88326276-88326298 TCATGGAAACAGAGAGTAGAAGG - Intergenic
993481955 5:88435058-88435080 TCATAGAAGTGGAGAGTATAAGG + Intergenic
993987027 5:94609836-94609858 ACATAGAAACAGAGCCTAGAAGG + Intronic
994234529 5:97345832-97345854 TCATGGATGTAGAGAGTAGAAGG - Intergenic
994974507 5:106784594-106784616 TCATAGAGACAGAGAGTAAAAGG + Intergenic
995137656 5:108697424-108697446 TCATAGAAGACAAGGGAAGAGGG - Intergenic
995230106 5:109751177-109751199 TCACAGAAGTGGAGAGTAGAAGG - Intronic
995726381 5:115185321-115185343 TCATAGAGACAGAAAGTAGAGGG + Intergenic
996034111 5:118739158-118739180 GCATAGAACCACAGGGTACAGGG - Intergenic
996192165 5:120558328-120558350 TCATGGAGACAGAGTGTAGAAGG - Intronic
997183952 5:131862629-131862651 TCATAAAAGCAGTGCTTAGAGGG - Intronic
997239841 5:132298418-132298440 TCACAGAAGCAGAAAGTAAATGG + Intronic
997260466 5:132462047-132462069 TCATAGAGACAGAAAGTAGAAGG + Exonic
998427072 5:142037940-142037962 TCATAGAGACAGAAAGTAGAAGG + Intergenic
998454242 5:142258647-142258669 GCATAGACGCACAGGGCAGAAGG + Intergenic
998866320 5:146506693-146506715 TCATAGAAATAGAGAGTAGATGG - Intronic
999717630 5:154374299-154374321 ACATACAACCAGAGGCTAGAAGG - Intronic
1000322259 5:160143838-160143860 TTATAGATTCAGAGGGTATATGG + Intergenic
1002376823 5:178794888-178794910 TCACAGAGGCAGAGGGCACAAGG + Intergenic
1002890717 6:1329297-1329319 TCATAGAAACAGAGACTAGATGG - Intergenic
1003126450 6:3360065-3360087 TCATAGAAACAGAAAGTAGAAGG + Intronic
1003219763 6:4148778-4148800 TCATAGATATAGAGAGTAGAAGG - Intergenic
1003673776 6:8183708-8183730 ACTTAGAGGCAGAGGGAAGATGG + Intergenic
1003933211 6:10948455-10948477 TCATAGAAACAGAGAGTAGAAGG + Intronic
1004682649 6:17911611-17911633 TCATAGACTCAGAGTGTAGAAGG + Intronic
1004815787 6:19310649-19310671 TCACAGAAGCAAAGAGTAGAAGG + Intergenic
1005103628 6:22200027-22200049 ACAGAGGAGCAGAGGGTGGAGGG - Intergenic
1007033037 6:38646383-38646405 TCTAAAAAGCAGATGGTAGAGGG - Intergenic
1007166522 6:39832285-39832307 GCATAGGAGGAGAGGGGAGAAGG - Intronic
1008510023 6:52267483-52267505 GGAGAGAAGTAGAGGGTAGAAGG - Intronic
1008802003 6:55379837-55379859 TCATAGATACAGAGAATAGAGGG - Intronic
1009484003 6:64197224-64197246 TCTCAACAGCAGAGGGTAGATGG - Intronic
1009540927 6:64957388-64957410 TCATGGACACAGAGAGTAGAAGG + Intronic
1010299055 6:74237432-74237454 TCATGGACACAGAGTGTAGAAGG - Intergenic
1010481723 6:76363182-76363204 TCATGGACACAGAGAGTAGAAGG - Intergenic
1010705186 6:79100365-79100387 TCATAGAAAAAGATAGTAGATGG - Intergenic
1010839352 6:80629958-80629980 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1011341999 6:86326483-86326505 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1012219800 6:96635373-96635395 TCATAGAATCTGAAGATAGATGG + Intergenic
1012779245 6:103535886-103535908 TCAGAAAAACAGAGGGAAGAGGG - Intergenic
1013278861 6:108615672-108615694 TCATAAAAGAAGAGGAAAGAGGG - Intronic
1013443582 6:110197623-110197645 TCATAGAAGCAGAGAGTGAATGG - Intronic
1014284894 6:119486242-119486264 TCACAGAGACAGAAGGTAGAAGG + Intergenic
1014297498 6:119637958-119637980 TCAAAGAACCGCAGGGTAGAGGG + Intergenic
1014829461 6:126084884-126084906 TCATAGAAACAGAGAGTAGAAGG + Intergenic
1014951574 6:127562117-127562139 TCATACAAGTAGAGAGTAGAAGG + Intronic
1015129186 6:129790929-129790951 TCATAGAAGCAGAGACTGGGTGG + Intergenic
1015792687 6:136979958-136979980 TCGTAGAACTAGAGGGTTGAGGG - Intergenic
1016011827 6:139144779-139144801 TCAATGAAGCAGAGGGCACATGG + Intronic
1016031981 6:139347329-139347351 TCATAGAAACTCAGAGTAGAGGG + Intergenic
1016708182 6:147138181-147138203 TCACAGTTCCAGAGGGTAGAAGG - Intergenic
1017207329 6:151817508-151817530 TTTCAGAAGCAGAGGGTAAAAGG + Intronic
1017294616 6:152779207-152779229 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1017319237 6:153069413-153069435 TCATGGACACAGAGAGTAGAGGG + Intronic
1017806331 6:157948794-157948816 TCACAGAGACAGAGAGTAGAAGG - Intergenic
1017850926 6:158305131-158305153 TCATAGAAACAGTAAGTAGAAGG - Intronic
1018211353 6:161484941-161484963 TCAAAGAAGCAGGGGGAAGCCGG - Intronic
1018332235 6:162742087-162742109 TCACAGAAGCAAAGAGTAGAAGG - Intronic
1018444803 6:163845901-163845923 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1018519677 6:164633479-164633501 TCACAAAAGCAGAGAGTAGAAGG - Intergenic
1019046547 6:169153609-169153631 TTACAGAAGCAGAGAGTAGAAGG - Intergenic
1019171656 6:170136420-170136442 TTAGAGAAGCAAAGGGTGGACGG - Intergenic
1019402637 7:865009-865031 TCATGGACAGAGAGGGTAGAAGG - Intronic
1020378226 7:7512171-7512193 TCACAGAAGCACAGAGTAGAAGG + Intronic
1020865104 7:13550324-13550346 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1021246376 7:18267477-18267499 TCATAGAAGTAGAGAGTAGAAGG - Intronic
1022203355 7:28139182-28139204 TCATAGATGGAGTGGGTTGATGG - Intronic
1022346558 7:29521278-29521300 TCATGGACACAGAGAGTAGAAGG + Intergenic
1022385708 7:29897020-29897042 TAATAGAGACAGAGAGTAGAAGG - Intronic
1022461255 7:30609981-30610003 TTATAGCTGCATAGGGTAGAAGG + Intronic
1022753253 7:33254691-33254713 TCATAGAAACAGAGAGTAGCAGG - Intronic
1023197150 7:37653487-37653509 AAATAGAAGCAGAGTATAGAGGG - Intergenic
1023265262 7:38398504-38398526 TCATGGAGACAGAGAGTAGAAGG + Intronic
1023941673 7:44772382-44772404 TCACAGAAGCAGCTGGTTGAGGG - Intergenic
1024020898 7:45367797-45367819 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1024364299 7:48503471-48503493 TCACAGAAAGAGAGAGTAGAAGG - Intronic
1024711262 7:52017505-52017527 TCAAAGAATCAGAGAATAGAAGG - Intergenic
1024933603 7:54690179-54690201 TCATGGCAGCAGGGGGTGGATGG - Intergenic
1025257504 7:57394868-57394890 TCACAGAAGCAGACAGTAGAAGG - Intergenic
1026098662 7:67367009-67367031 TTAGAGATGCAGAAGGTAGAAGG + Intergenic
1026294936 7:69043092-69043114 TCATGGAAATAGAGAGTAGAAGG + Intergenic
1026663486 7:72322622-72322644 TCATAGAGATAGAGAGTAGAAGG + Intronic
1027812710 7:82925629-82925651 GGGTAGAAGCAGAGGATAGAGGG - Intronic
1028205676 7:88013995-88014017 CCTTAGAAGGAGAGGGTAGTAGG - Intronic
1029063506 7:97824330-97824352 TTAAAGAAGCAGAGGGGAGCAGG + Intergenic
1029512847 7:101007431-101007453 TAATGGAGGCAGAGCGTAGAAGG - Intronic
1029519482 7:101051054-101051076 TCATGGCAGAAGAGGGAAGAAGG + Intronic
1030550358 7:110951078-110951100 TCATAGAAACAGAGAGTAGAAGG + Intronic
1030594646 7:111523077-111523099 TCATAAAAGTAGAGAGTAGAAGG + Intronic
1030684417 7:112469875-112469897 GCATTGAAGCAGAGGCTGGAGGG - Intronic
1030689737 7:112520067-112520089 TCCTATGAGGAGAGGGTAGATGG - Intergenic
1031387422 7:121168763-121168785 TCATAGACACAGAGAGTAGAAGG - Intronic
1031460964 7:122047984-122048006 TAATAGATGCAGAGGGAAAAGGG + Intronic
1032940683 7:136786481-136786503 TCATAGGAGCAGAGTGTAGAGGG - Intergenic
1032962317 7:137050749-137050771 TCATAGAAACAGAGAGTAGAAGG + Intergenic
1032972366 7:137179523-137179545 TCATGGATGTAGAGAGTAGAAGG + Intergenic
1032975890 7:137221798-137221820 ACATGGAAGCAGAATGTAGATGG + Intergenic
1033155734 7:138955428-138955450 TCATAGAGACAGAAAGTAGAAGG + Intronic
1033222170 7:139535326-139535348 TCATAGAGACAGAAAGTAGAAGG + Intronic
1033415720 7:141159769-141159791 TCATAGAGACAGAAGGTAGAAGG + Intronic
1033575576 7:142680747-142680769 CCACAGAAGCAGAGAGTAGAAGG + Intergenic
1033647120 7:143313996-143314018 TCATAGAAGCAGAAAGTAGAGGG - Intergenic
1033811141 7:145012765-145012787 TCATAGAACTAGAGAGTAGAAGG + Intergenic
1034975127 7:155444176-155444198 TCATAGAAGCAGAAAGTAGAAGG + Intergenic
1035063126 7:156084123-156084145 TCACAGAAGCAGAGAGCAGAAGG - Intergenic
1035451184 7:158977896-158977918 TCACAGAGACAGAAGGTAGAAGG - Intergenic
1035479198 7:159168628-159168650 TCATGGAAGCAGAGGCGGGATGG + Intergenic
1035622660 8:1045666-1045688 TCACAGAAGCAGCGAATAGAAGG - Intergenic
1036076151 8:5503076-5503098 TCACAGAAACAGAAGGTAAAAGG - Intergenic
1036481394 8:9142699-9142721 TCATAGAAACAGAGAGTACAGGG - Intronic
1037072550 8:14669508-14669530 TCATAGAAATAGAGAGTAGAAGG - Intronic
1037296125 8:17402439-17402461 ACATGGAGACAGAGGGTAGAAGG - Intronic
1037339767 8:17831926-17831948 TCATGGACGTAGAGAGTAGAAGG - Intergenic
1038283322 8:26184908-26184930 TCACAGAAGCAGAGAGTAGAGGG + Intergenic
1038309880 8:26438318-26438340 TCATAGAGACAGAAAGTAGATGG + Intronic
1039369255 8:36968180-36968202 TCATGGAAGCAAAGAGTAGGAGG + Intergenic
1039647031 8:39297813-39297835 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1039807435 8:41012633-41012655 GCATAGAGGCAGAGGCTGGAGGG - Intergenic
1039836675 8:41261735-41261757 TTATAGGAGCAGATGGTAAATGG + Intergenic
1040013672 8:42682943-42682965 TCACAGAAACAGAAAGTAGAAGG + Intergenic
1040295433 8:46146605-46146627 TGAGACAAGCAGAGGGGAGAAGG - Intergenic
1040737801 8:50531757-50531779 TCTTAGGAGCAGAGGTGAGATGG - Intronic
1041504091 8:58575055-58575077 TCACAGAAATAGAGAGTAGAAGG - Intronic
1041653776 8:60328124-60328146 TCACAGAAGCAGAGAGTAGAAGG + Intergenic
1041758677 8:61340373-61340395 TCACAGAAGTAGACAGTAGAAGG - Intronic
1041769244 8:61455392-61455414 TCATAGAAGTATAGAATAGAAGG - Intronic
1041785195 8:61623978-61624000 TCACAGAGGTAGAGGGTAGAAGG + Intronic
1041981022 8:63859748-63859770 TCATGGAAATAGAGAGTAGAAGG - Intergenic
1043029139 8:75109462-75109484 TCACAGAAGCAGAGAGTAGAAGG - Intergenic
1043374068 8:79627807-79627829 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1044076859 8:87832369-87832391 TCTTAGAAGAAGATGCTAGAGGG - Intergenic
1044105557 8:88201402-88201424 TCATATAATCACAGGGTACAAGG - Intronic
1044194238 8:89355109-89355131 TCATAGAAGTAGCAAGTAGAAGG + Intergenic
1044487820 8:92773028-92773050 TCATAGAGGTAGAGAGTAGAAGG - Intergenic
1045432939 8:102130405-102130427 TCATAGAAGTGGAGAGTAGATGG + Intergenic
1046315553 8:112496756-112496778 TCATGGAGTTAGAGGGTAGAAGG + Intronic
1046610932 8:116424844-116424866 TGATGGAAGCAGATGTTAGAGGG - Intergenic
1047057793 8:121186227-121186249 TCACGGAAGCAGAGAGCAGAAGG + Intergenic
1047072013 8:121355736-121355758 TCATAGAAGTAGAGAGTGGATGG - Intergenic
1047888996 8:129286487-129286509 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1048047666 8:130788444-130788466 TCATAGAAGTAGAGAGTCAATGG + Intronic
1048464936 8:134657641-134657663 TCAGAGAAGCACATGGAAGAAGG - Exonic
1048722879 8:137347123-137347145 TCATGGAGGTAGAGAGTAGAAGG - Intergenic
1048831958 8:138486296-138486318 TCAGAGGATCAGAGGGTAGTAGG + Intronic
1049270677 8:141694058-141694080 TAATAGAAGCAGAGGTTGGAGGG + Intergenic
1050356699 9:4790869-4790891 TCATGGAAATAGAGAGTAGAAGG + Intergenic
1050383488 9:5057880-5057902 TCATAGAATAAGAAAGTAGAGGG - Intronic
1050776541 9:9269811-9269833 TAATAGGAACAGAGAGTAGAAGG + Intronic
1050916384 9:11139997-11140019 TTATACAAGTAGAGAGTAGAAGG - Intergenic
1051058764 9:13021192-13021214 TCACTGTAGCAGAGAGTAGAAGG + Intergenic
1051224642 9:14886022-14886044 TCATAGAAGTAGAGAGTAGAAGG - Intronic
1051227662 9:14918959-14918981 TCATAGAAACTGAGAGTAGAAGG + Intergenic
1051567152 9:18513336-18513358 ACATAGAAGCAGACAGTAGAAGG - Intronic
1051644511 9:19254542-19254564 TCATAAAAGCAGAGCATACAAGG + Intronic
1052010445 9:23401655-23401677 TCATAGAAACAAAGACTAGAAGG + Intergenic
1052559503 9:30066925-30066947 TCATGGAAGCAGAGAGGTGAAGG + Intergenic
1052889192 9:33681598-33681620 CCACAGAAGCAGAGAGTAGAAGG + Intergenic
1053254191 9:36601756-36601778 TCATAGAGACAGAAGGCAGAAGG - Intronic
1053420817 9:37976512-37976534 TCATAGAGACAGAAAGTAGAAGG - Intronic
1053466661 9:38313408-38313430 TCTCTGAAGCAGAGGGTATATGG - Intergenic
1054746274 9:68857030-68857052 TGAGAGAAGCAGAGGTCAGAGGG + Intronic
1055176759 9:73327899-73327921 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1055178426 9:73350920-73350942 TCATAGAAGCAGACAGTAGAAGG - Intergenic
1055341725 9:75291678-75291700 TCATGGACACAGAGTGTAGAAGG - Intergenic
1055527609 9:77151118-77151140 AAAGAGAAGAAGAGGGTAGATGG + Intergenic
1056067963 9:82956635-82956657 TCATGGACATAGAGGGTAGAAGG + Intergenic
1056684497 9:88748390-88748412 TCTTAGAAGCAGAAAGTAGAAGG - Intergenic
1057021445 9:91700957-91700979 TCATAGAAGTAGAGACTAGGTGG - Intronic
1057056587 9:91966261-91966283 TCCTAGGAGCAGAGGGCACAGGG - Intergenic
1058053685 9:100429181-100429203 GCATTGAAGCAGAGAGTAGGTGG + Intronic
1058085265 9:100741313-100741335 TCATGAAGGCAGAGAGTAGAAGG - Intergenic
1058398274 9:104581369-104581391 TCATAGAAGCAGAGGTAGAATGG - Intergenic
1058411421 9:104737447-104737469 TCATAGATACAGAAAGTAGAAGG + Intergenic
1058462578 9:105196812-105196834 TTATAGAAGCTGAGAGAAGATGG + Intergenic
1058527527 9:105874947-105874969 TCCCAGAAGCTGAGGGTACAAGG - Intergenic
1058752767 9:108054959-108054981 TCAGAGAAACACAGGGTTGAAGG + Intergenic
1059003682 9:110377900-110377922 TCATAGAAGCAGAGAGTAGATGG - Intronic
1059160688 9:112032270-112032292 TCATAGAAACAGAGAGCAAAAGG + Intergenic
1059676656 9:116546928-116546950 TCATAGAAGCTGCGGGCAGCTGG - Intronic
1060097078 9:120800900-120800922 TCATAGAAACAGAGAGTAAATGG - Intergenic
1060602871 9:124889668-124889690 TCATAGGAGCAGAGCTTAGCTGG - Intronic
1060735934 9:126066633-126066655 TCATTGAGGCAGGGGGTAGTTGG + Intergenic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1203718775 Un_KI270742v1:182776-182798 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1203653003 Un_KI270751v1:146450-146472 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1185887324 X:3794388-3794410 TCATAGAAGCAGAGGATGAATGG - Intergenic
1185939763 X:4303212-4303234 TCATAGACATAGAGAGTAGAAGG - Intergenic
1185940188 X:4309342-4309364 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1185967344 X:4622468-4622490 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1186033712 X:5397502-5397524 GCAAAGAGGCAGAGGCTAGAGGG + Intergenic
1186175522 X:6922064-6922086 TCATGGACACAGAGAGTAGAAGG + Intergenic
1186226952 X:7409468-7409490 TCATGGAGACAGAGAGTAGATGG - Intergenic
1186551651 X:10512138-10512160 TCAAAGAAGTTGAGGTTAGAGGG + Intronic
1186878633 X:13841872-13841894 TCCAAGAAGCAGAGGTGAGAAGG - Intronic
1187105988 X:16242339-16242361 TCATGGAGATAGAGGGTAGAGGG - Intergenic
1187189343 X:17018492-17018514 TCATAGAACCAGAAAGTAGATGG - Intronic
1187192715 X:17051041-17051063 TCATGGACACAGAGAGTAGAAGG - Intronic
1187670450 X:21661060-21661082 TCATGGACACAGAGAGTAGAAGG - Intergenic
1187843943 X:23516666-23516688 TCATGGAAATAGAGAGTAGAAGG - Intergenic
1187845402 X:23531383-23531405 TCATGGAGATAGAGGGTAGAAGG + Intergenic
1188106472 X:26153454-26153476 TCATGGAAACAGAGAGTAAAAGG - Intergenic
1188648949 X:32606207-32606229 TCATGGAAATAGAGAGTAGAAGG - Intronic
1188724371 X:33563686-33563708 TCATGGACACAGAGAGTAGAAGG + Intergenic
1188745205 X:33832788-33832810 TCATGGACACAGAGAGTAGAAGG - Intergenic
1188915092 X:35900902-35900924 TCATGGAGGTAGAGAGTAGAGGG - Intergenic
1188959379 X:36471333-36471355 TCATAGAAGTAAAGGGTAGATGG + Intergenic
1189023714 X:37370028-37370050 TAATAGAAGCAGAGAGTAAGTGG - Intronic
1189033708 X:37475041-37475063 TCATGGACGTAGAGAGTAGAAGG + Intronic
1189572485 X:42313097-42313119 TCATGGACACAGAGAGTAGAAGG - Intergenic
1189657409 X:43259971-43259993 TCATGGATACAGAGAGTAGAAGG - Intergenic
1189887814 X:45566875-45566897 CCATAGAAATAGAAGGTAGAAGG + Intergenic
1190012249 X:46795458-46795480 TCATAGAGACAGAAAGTAGAAGG - Intergenic
1190254357 X:48751487-48751509 TCATAGAAACAGAAAGTAGAAGG + Intergenic
1190482862 X:50894801-50894823 TCATGGACGTAGAGAGTAGAGGG + Intergenic
1190558308 X:51660681-51660703 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1190578208 X:51863151-51863173 TCATAGAAACAGAGAGTGGATGG - Intronic
1190641987 X:52488671-52488693 TCATGGACACAGAGAGTAGAAGG - Intergenic
1190645685 X:52524195-52524217 TCATGGACACAGAGAGTAGAAGG + Intergenic
1190806313 X:53840889-53840911 TCATGGACGTAGAGAGTAGAAGG + Intergenic
1191051900 X:56202612-56202634 TCATAGACACAGAGAGTAGAAGG - Intergenic
1191126465 X:56960323-56960345 TCATTGAAATAGAGAGTAGAAGG + Intergenic
1191610417 X:63105911-63105933 ACATATAAGCAGTGTGTAGAGGG + Intergenic
1192079971 X:68038363-68038385 TCATGGAGGTAGAGAGTAGAAGG + Intergenic
1192488341 X:71550859-71550881 TCATAGAAACAGAGAGTAGAAGG + Intronic
1192757280 X:74059545-74059567 TCATAGAAACAAAAAGTAGAGGG + Intergenic
1192838101 X:74824306-74824328 TCATGGAATCAGATAGTAGATGG - Intronic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1193122290 X:77836196-77836218 TCATGGACACAGAGAGTAGAAGG + Intronic
1193292993 X:79799423-79799445 TTATAGACACAGAGAGTAGAAGG - Intergenic
1193557105 X:82968330-82968352 TTATGGAAGCAAAGGATAGAGGG + Intergenic
1193579173 X:83241813-83241835 TCATGGACACAGAGGGTAGAAGG + Intergenic
1193693317 X:84675090-84675112 TCATGGGAGTAGAGAGTAGAAGG + Intergenic
1194167187 X:90532191-90532213 TCATAGATATAGAGAGTAGAAGG + Intergenic
1194216622 X:91137083-91137105 TCATGGAGGTAGAGAGTAGAAGG + Intergenic
1194529051 X:95021531-95021553 TCATAGAAACGGAGAGTAGAAGG + Intergenic
1194562899 X:95445554-95445576 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1194720108 X:97330360-97330382 TCATAGAAACAGAGAGTAGGTGG - Intronic
1194783330 X:98051457-98051479 TCATGGACACAGAGAGTAGAAGG - Intergenic
1194940415 X:100002658-100002680 TCACAGAAGCAGACAGTGGAAGG + Intergenic
1195279767 X:103320052-103320074 TCATAGAGATAGAGAGTAGAAGG - Intergenic
1195304303 X:103564261-103564283 TCATGGAAATAGAGAGTAGAAGG + Intergenic
1195312866 X:103650270-103650292 TCATGGAAATAGAGAGTAGAAGG + Intergenic
1195712250 X:107782645-107782667 TCATCAAAGCAGAGAGTAGATGG - Intronic
1195813921 X:108864677-108864699 TCATAGAGGCAGAGAGTAAATGG - Intergenic
1195819791 X:108931382-108931404 TCATGGAGACAGAGAGTAGAAGG - Intergenic
1195986274 X:110634126-110634148 TCATGGAGACAGAGTGTAGAAGG + Intergenic
1196067549 X:111481758-111481780 TCATAGAACCAGAGGATCAAGGG + Intergenic
1196487211 X:116226151-116226173 TCACAGAAGCAGAAAGTAAATGG + Intergenic
1197085894 X:122474805-122474827 TCATAGAAGCCAACAGTAGAAGG + Intergenic
1197370108 X:125615300-125615322 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1197440481 X:126482446-126482468 TCATGGAGACAGAGAGTAGAAGG + Intergenic
1197449156 X:126589695-126589717 TCATGGTCGCAGAGAGTAGAAGG - Intergenic
1197587049 X:128361412-128361434 TCATGGAGGTAGAGAGTAGAAGG - Intergenic
1197716130 X:129707212-129707234 TCTAAGAATCAGAGGGGAGAAGG - Intergenic
1197958892 X:131982460-131982482 TCTTAGAATCAGAGGATAAAAGG - Intergenic
1197998260 X:132404032-132404054 GCATAGAAACAGAGAGTAGAAGG - Intronic
1198482504 X:137053675-137053697 ACATAAAAGGAGAGGGGAGAAGG - Intergenic
1198488847 X:137117661-137117683 TCATGGAAATAGAGAGTAGAAGG + Intergenic
1198514660 X:137393644-137393666 TCATGGAAATAGAGAGTAGAAGG - Intergenic
1198885951 X:141337423-141337445 ATATAGAAACAGAGAGTAGAAGG - Intergenic
1199115032 X:143981733-143981755 TCATGGATGTAGAGAGTAGAAGG - Intergenic
1199222371 X:145332355-145332377 TTATAGAAGTAGAGAGTAGAAGG - Intergenic
1199366691 X:146994589-146994611 TCATAGACATAGAGAGTAGAAGG + Intergenic
1199372134 X:147062237-147062259 TTATAGAAGTAGAGGGTAGAGGG + Intergenic
1199775452 X:151006956-151006978 TCATAGAGGCAGAGAGTAGAAGG - Intergenic
1200513451 Y:4109967-4109989 TCATAGATATAGAGAGTAGAAGG + Intergenic
1200519380 Y:4191781-4191803 TCATGGAAGTAGACAGTAGATGG - Intergenic
1200682183 Y:6225803-6225825 TCATAGACAGAGAGAGTAGAAGG - Intergenic
1200775021 Y:7162754-7162776 TCATAGAAGCAGAGGATGAATGG + Intergenic
1200795252 Y:7335220-7335242 TCATAGGGACAGAAGGTAGATGG + Intergenic
1201172933 Y:11287612-11287634 TCATACCCTCAGAGGGTAGAGGG - Intergenic
1201531014 Y:14989778-14989800 CCATAGATGGAGATGGTAGAGGG - Intergenic
1201709620 Y:16976160-16976182 TCATAGAAGTAGAGAATAGATGG + Intergenic
1201723079 Y:17123796-17123818 TCATAGACATAGAGAGTAGAAGG - Intergenic
1201907263 Y:19098501-19098523 TCATAGAAGCAGAGGATGAATGG + Intergenic