ID: 961651745

View in Genome Browser
Species Human (GRCh38)
Location 3:128420426-128420448
Sequence AGCCCACAGCCTCCCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961651741_961651745 -10 Left 961651741 3:128420413-128420435 CCCTCAGGGCCTGAGCCCACAGC No data
Right 961651745 3:128420426-128420448 AGCCCACAGCCTCCCAGGAGAGG No data
961651737_961651745 13 Left 961651737 3:128420390-128420412 CCCTGGCAGGTGGGCTGGGGGCG No data
Right 961651745 3:128420426-128420448 AGCCCACAGCCTCCCAGGAGAGG No data
961651738_961651745 12 Left 961651738 3:128420391-128420413 CCTGGCAGGTGGGCTGGGGGCGC No data
Right 961651745 3:128420426-128420448 AGCCCACAGCCTCCCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961651745 Original CRISPR AGCCCACAGCCTCCCAGGAG AGG Intergenic
No off target data available for this crispr