ID: 961653269

View in Genome Browser
Species Human (GRCh38)
Location 3:128428066-128428088
Sequence ATGGACAAAAGCCCCCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961653264_961653269 29 Left 961653264 3:128428014-128428036 CCTTCTTTGATTTAATTAAAAGC No data
Right 961653269 3:128428066-128428088 ATGGACAAAAGCCCCCATGTGGG No data
961653265_961653269 7 Left 961653265 3:128428036-128428058 CCCTTTTGTGTGTCTCTTGTCAC No data
Right 961653269 3:128428066-128428088 ATGGACAAAAGCCCCCATGTGGG No data
961653263_961653269 30 Left 961653263 3:128428013-128428035 CCCTTCTTTGATTTAATTAAAAG No data
Right 961653269 3:128428066-128428088 ATGGACAAAAGCCCCCATGTGGG No data
961653266_961653269 6 Left 961653266 3:128428037-128428059 CCTTTTGTGTGTCTCTTGTCACT No data
Right 961653269 3:128428066-128428088 ATGGACAAAAGCCCCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961653269 Original CRISPR ATGGACAAAAGCCCCCATGT GGG Intergenic
No off target data available for this crispr