ID: 961653848

View in Genome Browser
Species Human (GRCh38)
Location 3:128430776-128430798
Sequence ATCCTTAGCCAAAGTGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961653845_961653848 10 Left 961653845 3:128430743-128430765 CCAAATACACTCGTAAAGTGACT No data
Right 961653848 3:128430776-128430798 ATCCTTAGCCAAAGTGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961653848 Original CRISPR ATCCTTAGCCAAAGTGGGCA CGG Intergenic
No off target data available for this crispr