ID: 961654724

View in Genome Browser
Species Human (GRCh38)
Location 3:128435056-128435078
Sequence GGGATCGCTGCAGAGAGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961654724_961654736 24 Left 961654724 3:128435056-128435078 CCTCGACTCTCTGCAGCGATCCC No data
Right 961654736 3:128435103-128435125 TCCCTGGCAGCTGAGCAACTGGG No data
961654724_961654739 28 Left 961654724 3:128435056-128435078 CCTCGACTCTCTGCAGCGATCCC No data
Right 961654739 3:128435107-128435129 TGGCAGCTGAGCAACTGGGTAGG No data
961654724_961654735 23 Left 961654724 3:128435056-128435078 CCTCGACTCTCTGCAGCGATCCC No data
Right 961654735 3:128435102-128435124 CTCCCTGGCAGCTGAGCAACTGG No data
961654724_961654732 8 Left 961654724 3:128435056-128435078 CCTCGACTCTCTGCAGCGATCCC No data
Right 961654732 3:128435087-128435109 TGGCCCTGGCTGTGACTCCCTGG No data
961654724_961654726 -6 Left 961654724 3:128435056-128435078 CCTCGACTCTCTGCAGCGATCCC No data
Right 961654726 3:128435073-128435095 GATCCCTCCCTTCCTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961654724 Original CRISPR GGGATCGCTGCAGAGAGTCG AGG (reversed) Intergenic
No off target data available for this crispr