ID: 961654727

View in Genome Browser
Species Human (GRCh38)
Location 3:128435076-128435098
Sequence CAGCCAGGGCCAGGAAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961654727_961654739 8 Left 961654727 3:128435076-128435098 CCCTCCCTTCCTGGCCCTGGCTG No data
Right 961654739 3:128435107-128435129 TGGCAGCTGAGCAACTGGGTAGG No data
961654727_961654736 4 Left 961654727 3:128435076-128435098 CCCTCCCTTCCTGGCCCTGGCTG No data
Right 961654736 3:128435103-128435125 TCCCTGGCAGCTGAGCAACTGGG No data
961654727_961654742 20 Left 961654727 3:128435076-128435098 CCCTCCCTTCCTGGCCCTGGCTG No data
Right 961654742 3:128435119-128435141 AACTGGGTAGGAGAGGGACATGG No data
961654727_961654740 13 Left 961654727 3:128435076-128435098 CCCTCCCTTCCTGGCCCTGGCTG No data
Right 961654740 3:128435112-128435134 GCTGAGCAACTGGGTAGGAGAGG No data
961654727_961654741 14 Left 961654727 3:128435076-128435098 CCCTCCCTTCCTGGCCCTGGCTG No data
Right 961654741 3:128435113-128435135 CTGAGCAACTGGGTAGGAGAGGG No data
961654727_961654735 3 Left 961654727 3:128435076-128435098 CCCTCCCTTCCTGGCCCTGGCTG No data
Right 961654735 3:128435102-128435124 CTCCCTGGCAGCTGAGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961654727 Original CRISPR CAGCCAGGGCCAGGAAGGGA GGG (reversed) Intergenic
No off target data available for this crispr