ID: 961654729

View in Genome Browser
Species Human (GRCh38)
Location 3:128435080-128435102
Sequence GTCACAGCCAGGGCCAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 1, 2: 2, 3: 70, 4: 549}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961654729_961654742 16 Left 961654729 3:128435080-128435102 CCCTTCCTGGCCCTGGCTGTGAC 0: 1
1: 1
2: 2
3: 70
4: 549
Right 961654742 3:128435119-128435141 AACTGGGTAGGAGAGGGACATGG No data
961654729_961654739 4 Left 961654729 3:128435080-128435102 CCCTTCCTGGCCCTGGCTGTGAC 0: 1
1: 1
2: 2
3: 70
4: 549
Right 961654739 3:128435107-128435129 TGGCAGCTGAGCAACTGGGTAGG No data
961654729_961654741 10 Left 961654729 3:128435080-128435102 CCCTTCCTGGCCCTGGCTGTGAC 0: 1
1: 1
2: 2
3: 70
4: 549
Right 961654741 3:128435113-128435135 CTGAGCAACTGGGTAGGAGAGGG No data
961654729_961654735 -1 Left 961654729 3:128435080-128435102 CCCTTCCTGGCCCTGGCTGTGAC 0: 1
1: 1
2: 2
3: 70
4: 549
Right 961654735 3:128435102-128435124 CTCCCTGGCAGCTGAGCAACTGG No data
961654729_961654740 9 Left 961654729 3:128435080-128435102 CCCTTCCTGGCCCTGGCTGTGAC 0: 1
1: 1
2: 2
3: 70
4: 549
Right 961654740 3:128435112-128435134 GCTGAGCAACTGGGTAGGAGAGG No data
961654729_961654736 0 Left 961654729 3:128435080-128435102 CCCTTCCTGGCCCTGGCTGTGAC 0: 1
1: 1
2: 2
3: 70
4: 549
Right 961654736 3:128435103-128435125 TCCCTGGCAGCTGAGCAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961654729 Original CRISPR GTCACAGCCAGGGCCAGGAA GGG (reversed) Intergenic