ID: 961654731

View in Genome Browser
Species Human (GRCh38)
Location 3:128435085-128435107
Sequence AGGGAGTCACAGCCAGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961654731_961654742 11 Left 961654731 3:128435085-128435107 CCTGGCCCTGGCTGTGACTCCCT No data
Right 961654742 3:128435119-128435141 AACTGGGTAGGAGAGGGACATGG No data
961654731_961654735 -6 Left 961654731 3:128435085-128435107 CCTGGCCCTGGCTGTGACTCCCT No data
Right 961654735 3:128435102-128435124 CTCCCTGGCAGCTGAGCAACTGG No data
961654731_961654741 5 Left 961654731 3:128435085-128435107 CCTGGCCCTGGCTGTGACTCCCT No data
Right 961654741 3:128435113-128435135 CTGAGCAACTGGGTAGGAGAGGG No data
961654731_961654740 4 Left 961654731 3:128435085-128435107 CCTGGCCCTGGCTGTGACTCCCT No data
Right 961654740 3:128435112-128435134 GCTGAGCAACTGGGTAGGAGAGG No data
961654731_961654739 -1 Left 961654731 3:128435085-128435107 CCTGGCCCTGGCTGTGACTCCCT No data
Right 961654739 3:128435107-128435129 TGGCAGCTGAGCAACTGGGTAGG No data
961654731_961654743 28 Left 961654731 3:128435085-128435107 CCTGGCCCTGGCTGTGACTCCCT No data
Right 961654743 3:128435136-128435158 ACATGGCTCAGTCTGTCTGTTGG No data
961654731_961654736 -5 Left 961654731 3:128435085-128435107 CCTGGCCCTGGCTGTGACTCCCT No data
Right 961654736 3:128435103-128435125 TCCCTGGCAGCTGAGCAACTGGG No data
961654731_961654744 29 Left 961654731 3:128435085-128435107 CCTGGCCCTGGCTGTGACTCCCT No data
Right 961654744 3:128435137-128435159 CATGGCTCAGTCTGTCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961654731 Original CRISPR AGGGAGTCACAGCCAGGGCC AGG (reversed) Intergenic
No off target data available for this crispr