ID: 961654732

View in Genome Browser
Species Human (GRCh38)
Location 3:128435087-128435109
Sequence TGGCCCTGGCTGTGACTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961654724_961654732 8 Left 961654724 3:128435056-128435078 CCTCGACTCTCTGCAGCGATCCC No data
Right 961654732 3:128435087-128435109 TGGCCCTGGCTGTGACTCCCTGG No data
961654723_961654732 30 Left 961654723 3:128435034-128435056 CCTGGGAGCTCACTGCGTGGCTC No data
Right 961654732 3:128435087-128435109 TGGCCCTGGCTGTGACTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961654732 Original CRISPR TGGCCCTGGCTGTGACTCCC TGG Intergenic
No off target data available for this crispr