ID: 961654733

View in Genome Browser
Species Human (GRCh38)
Location 3:128435090-128435112
Sequence CTGCCAGGGAGTCACAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961654733_961654736 -10 Left 961654733 3:128435090-128435112 CCCTGGCTGTGACTCCCTGGCAG No data
Right 961654736 3:128435103-128435125 TCCCTGGCAGCTGAGCAACTGGG No data
961654733_961654744 24 Left 961654733 3:128435090-128435112 CCCTGGCTGTGACTCCCTGGCAG No data
Right 961654744 3:128435137-128435159 CATGGCTCAGTCTGTCTGTTGGG No data
961654733_961654739 -6 Left 961654733 3:128435090-128435112 CCCTGGCTGTGACTCCCTGGCAG No data
Right 961654739 3:128435107-128435129 TGGCAGCTGAGCAACTGGGTAGG No data
961654733_961654740 -1 Left 961654733 3:128435090-128435112 CCCTGGCTGTGACTCCCTGGCAG No data
Right 961654740 3:128435112-128435134 GCTGAGCAACTGGGTAGGAGAGG No data
961654733_961654743 23 Left 961654733 3:128435090-128435112 CCCTGGCTGTGACTCCCTGGCAG No data
Right 961654743 3:128435136-128435158 ACATGGCTCAGTCTGTCTGTTGG No data
961654733_961654741 0 Left 961654733 3:128435090-128435112 CCCTGGCTGTGACTCCCTGGCAG No data
Right 961654741 3:128435113-128435135 CTGAGCAACTGGGTAGGAGAGGG No data
961654733_961654742 6 Left 961654733 3:128435090-128435112 CCCTGGCTGTGACTCCCTGGCAG No data
Right 961654742 3:128435119-128435141 AACTGGGTAGGAGAGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961654733 Original CRISPR CTGCCAGGGAGTCACAGCCA GGG (reversed) Intergenic
No off target data available for this crispr