ID: 961654735

View in Genome Browser
Species Human (GRCh38)
Location 3:128435102-128435124
Sequence CTCCCTGGCAGCTGAGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961654728_961654735 2 Left 961654728 3:128435077-128435099 CCTCCCTTCCTGGCCCTGGCTGT No data
Right 961654735 3:128435102-128435124 CTCCCTGGCAGCTGAGCAACTGG No data
961654729_961654735 -1 Left 961654729 3:128435080-128435102 CCCTTCCTGGCCCTGGCTGTGAC No data
Right 961654735 3:128435102-128435124 CTCCCTGGCAGCTGAGCAACTGG No data
961654724_961654735 23 Left 961654724 3:128435056-128435078 CCTCGACTCTCTGCAGCGATCCC No data
Right 961654735 3:128435102-128435124 CTCCCTGGCAGCTGAGCAACTGG No data
961654730_961654735 -2 Left 961654730 3:128435081-128435103 CCTTCCTGGCCCTGGCTGTGACT No data
Right 961654735 3:128435102-128435124 CTCCCTGGCAGCTGAGCAACTGG No data
961654727_961654735 3 Left 961654727 3:128435076-128435098 CCCTCCCTTCCTGGCCCTGGCTG No data
Right 961654735 3:128435102-128435124 CTCCCTGGCAGCTGAGCAACTGG No data
961654731_961654735 -6 Left 961654731 3:128435085-128435107 CCTGGCCCTGGCTGTGACTCCCT No data
Right 961654735 3:128435102-128435124 CTCCCTGGCAGCTGAGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961654735 Original CRISPR CTCCCTGGCAGCTGAGCAAC TGG Intergenic
No off target data available for this crispr