ID: 961654737

View in Genome Browser
Species Human (GRCh38)
Location 3:128435104-128435126
Sequence ACCCAGTTGCTCAGCTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961654737_961654742 -8 Left 961654737 3:128435104-128435126 CCCTGGCAGCTGAGCAACTGGGT No data
Right 961654742 3:128435119-128435141 AACTGGGTAGGAGAGGGACATGG No data
961654737_961654744 10 Left 961654737 3:128435104-128435126 CCCTGGCAGCTGAGCAACTGGGT No data
Right 961654744 3:128435137-128435159 CATGGCTCAGTCTGTCTGTTGGG No data
961654737_961654743 9 Left 961654737 3:128435104-128435126 CCCTGGCAGCTGAGCAACTGGGT No data
Right 961654743 3:128435136-128435158 ACATGGCTCAGTCTGTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961654737 Original CRISPR ACCCAGTTGCTCAGCTGCCA GGG (reversed) Intergenic
No off target data available for this crispr