ID: 961654738

View in Genome Browser
Species Human (GRCh38)
Location 3:128435105-128435127
Sequence TACCCAGTTGCTCAGCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961654738_961654743 8 Left 961654738 3:128435105-128435127 CCTGGCAGCTGAGCAACTGGGTA No data
Right 961654743 3:128435136-128435158 ACATGGCTCAGTCTGTCTGTTGG No data
961654738_961654742 -9 Left 961654738 3:128435105-128435127 CCTGGCAGCTGAGCAACTGGGTA No data
Right 961654742 3:128435119-128435141 AACTGGGTAGGAGAGGGACATGG No data
961654738_961654744 9 Left 961654738 3:128435105-128435127 CCTGGCAGCTGAGCAACTGGGTA No data
Right 961654744 3:128435137-128435159 CATGGCTCAGTCTGTCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961654738 Original CRISPR TACCCAGTTGCTCAGCTGCC AGG (reversed) Intergenic
No off target data available for this crispr