ID: 961654741

View in Genome Browser
Species Human (GRCh38)
Location 3:128435113-128435135
Sequence CTGAGCAACTGGGTAGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961654729_961654741 10 Left 961654729 3:128435080-128435102 CCCTTCCTGGCCCTGGCTGTGAC No data
Right 961654741 3:128435113-128435135 CTGAGCAACTGGGTAGGAGAGGG No data
961654730_961654741 9 Left 961654730 3:128435081-128435103 CCTTCCTGGCCCTGGCTGTGACT No data
Right 961654741 3:128435113-128435135 CTGAGCAACTGGGTAGGAGAGGG No data
961654731_961654741 5 Left 961654731 3:128435085-128435107 CCTGGCCCTGGCTGTGACTCCCT No data
Right 961654741 3:128435113-128435135 CTGAGCAACTGGGTAGGAGAGGG No data
961654733_961654741 0 Left 961654733 3:128435090-128435112 CCCTGGCTGTGACTCCCTGGCAG No data
Right 961654741 3:128435113-128435135 CTGAGCAACTGGGTAGGAGAGGG No data
961654734_961654741 -1 Left 961654734 3:128435091-128435113 CCTGGCTGTGACTCCCTGGCAGC No data
Right 961654741 3:128435113-128435135 CTGAGCAACTGGGTAGGAGAGGG No data
961654727_961654741 14 Left 961654727 3:128435076-128435098 CCCTCCCTTCCTGGCCCTGGCTG No data
Right 961654741 3:128435113-128435135 CTGAGCAACTGGGTAGGAGAGGG No data
961654728_961654741 13 Left 961654728 3:128435077-128435099 CCTCCCTTCCTGGCCCTGGCTGT No data
Right 961654741 3:128435113-128435135 CTGAGCAACTGGGTAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961654741 Original CRISPR CTGAGCAACTGGGTAGGAGA GGG Intergenic
No off target data available for this crispr