ID: 961654742

View in Genome Browser
Species Human (GRCh38)
Location 3:128435119-128435141
Sequence AACTGGGTAGGAGAGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961654733_961654742 6 Left 961654733 3:128435090-128435112 CCCTGGCTGTGACTCCCTGGCAG No data
Right 961654742 3:128435119-128435141 AACTGGGTAGGAGAGGGACATGG No data
961654730_961654742 15 Left 961654730 3:128435081-128435103 CCTTCCTGGCCCTGGCTGTGACT No data
Right 961654742 3:128435119-128435141 AACTGGGTAGGAGAGGGACATGG No data
961654731_961654742 11 Left 961654731 3:128435085-128435107 CCTGGCCCTGGCTGTGACTCCCT No data
Right 961654742 3:128435119-128435141 AACTGGGTAGGAGAGGGACATGG No data
961654737_961654742 -8 Left 961654737 3:128435104-128435126 CCCTGGCAGCTGAGCAACTGGGT No data
Right 961654742 3:128435119-128435141 AACTGGGTAGGAGAGGGACATGG No data
961654738_961654742 -9 Left 961654738 3:128435105-128435127 CCTGGCAGCTGAGCAACTGGGTA No data
Right 961654742 3:128435119-128435141 AACTGGGTAGGAGAGGGACATGG No data
961654734_961654742 5 Left 961654734 3:128435091-128435113 CCTGGCTGTGACTCCCTGGCAGC No data
Right 961654742 3:128435119-128435141 AACTGGGTAGGAGAGGGACATGG No data
961654727_961654742 20 Left 961654727 3:128435076-128435098 CCCTCCCTTCCTGGCCCTGGCTG No data
Right 961654742 3:128435119-128435141 AACTGGGTAGGAGAGGGACATGG No data
961654729_961654742 16 Left 961654729 3:128435080-128435102 CCCTTCCTGGCCCTGGCTGTGAC No data
Right 961654742 3:128435119-128435141 AACTGGGTAGGAGAGGGACATGG No data
961654728_961654742 19 Left 961654728 3:128435077-128435099 CCTCCCTTCCTGGCCCTGGCTGT No data
Right 961654742 3:128435119-128435141 AACTGGGTAGGAGAGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961654742 Original CRISPR AACTGGGTAGGAGAGGGACA TGG Intergenic
No off target data available for this crispr