ID: 961654744

View in Genome Browser
Species Human (GRCh38)
Location 3:128435137-128435159
Sequence CATGGCTCAGTCTGTCTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961654737_961654744 10 Left 961654737 3:128435104-128435126 CCCTGGCAGCTGAGCAACTGGGT No data
Right 961654744 3:128435137-128435159 CATGGCTCAGTCTGTCTGTTGGG No data
961654738_961654744 9 Left 961654738 3:128435105-128435127 CCTGGCAGCTGAGCAACTGGGTA No data
Right 961654744 3:128435137-128435159 CATGGCTCAGTCTGTCTGTTGGG No data
961654733_961654744 24 Left 961654733 3:128435090-128435112 CCCTGGCTGTGACTCCCTGGCAG No data
Right 961654744 3:128435137-128435159 CATGGCTCAGTCTGTCTGTTGGG No data
961654731_961654744 29 Left 961654731 3:128435085-128435107 CCTGGCCCTGGCTGTGACTCCCT No data
Right 961654744 3:128435137-128435159 CATGGCTCAGTCTGTCTGTTGGG No data
961654734_961654744 23 Left 961654734 3:128435091-128435113 CCTGGCTGTGACTCCCTGGCAGC No data
Right 961654744 3:128435137-128435159 CATGGCTCAGTCTGTCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961654744 Original CRISPR CATGGCTCAGTCTGTCTGTT GGG Intergenic
No off target data available for this crispr