ID: 961657282

View in Genome Browser
Species Human (GRCh38)
Location 3:128450116-128450138
Sequence TCCTCCCCAGCCGGGCATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961657275_961657282 4 Left 961657275 3:128450089-128450111 CCCTGCTCTGTGTCCTCTGAAGG No data
Right 961657282 3:128450116-128450138 TCCTCCCCAGCCGGGCATTAAGG No data
961657269_961657282 20 Left 961657269 3:128450073-128450095 CCCTCCCTCCAGAGACCCCTGCT No data
Right 961657282 3:128450116-128450138 TCCTCCCCAGCCGGGCATTAAGG No data
961657271_961657282 16 Left 961657271 3:128450077-128450099 CCCTCCAGAGACCCCTGCTCTGT No data
Right 961657282 3:128450116-128450138 TCCTCCCCAGCCGGGCATTAAGG No data
961657267_961657282 28 Left 961657267 3:128450065-128450087 CCCGCAGTCCCTCCCTCCAGAGA No data
Right 961657282 3:128450116-128450138 TCCTCCCCAGCCGGGCATTAAGG No data
961657270_961657282 19 Left 961657270 3:128450074-128450096 CCTCCCTCCAGAGACCCCTGCTC No data
Right 961657282 3:128450116-128450138 TCCTCCCCAGCCGGGCATTAAGG No data
961657279_961657282 -9 Left 961657279 3:128450102-128450124 CCTCTGAAGGGCTCTCCTCCCCA No data
Right 961657282 3:128450116-128450138 TCCTCCCCAGCCGGGCATTAAGG No data
961657277_961657282 3 Left 961657277 3:128450090-128450112 CCTGCTCTGTGTCCTCTGAAGGG No data
Right 961657282 3:128450116-128450138 TCCTCCCCAGCCGGGCATTAAGG No data
961657274_961657282 5 Left 961657274 3:128450088-128450110 CCCCTGCTCTGTGTCCTCTGAAG No data
Right 961657282 3:128450116-128450138 TCCTCCCCAGCCGGGCATTAAGG No data
961657268_961657282 27 Left 961657268 3:128450066-128450088 CCGCAGTCCCTCCCTCCAGAGAC No data
Right 961657282 3:128450116-128450138 TCCTCCCCAGCCGGGCATTAAGG No data
961657266_961657282 29 Left 961657266 3:128450064-128450086 CCCCGCAGTCCCTCCCTCCAGAG No data
Right 961657282 3:128450116-128450138 TCCTCCCCAGCCGGGCATTAAGG No data
961657272_961657282 15 Left 961657272 3:128450078-128450100 CCTCCAGAGACCCCTGCTCTGTG No data
Right 961657282 3:128450116-128450138 TCCTCCCCAGCCGGGCATTAAGG No data
961657273_961657282 12 Left 961657273 3:128450081-128450103 CCAGAGACCCCTGCTCTGTGTCC No data
Right 961657282 3:128450116-128450138 TCCTCCCCAGCCGGGCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961657282 Original CRISPR TCCTCCCCAGCCGGGCATTA AGG Intergenic