ID: 961661592

View in Genome Browser
Species Human (GRCh38)
Location 3:128471578-128471600
Sequence CAAAGGGAACAGCATGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961661588_961661592 3 Left 961661588 3:128471552-128471574 CCTTGTAACATGGGAGTGGTTCC No data
Right 961661592 3:128471578-128471600 CAAAGGGAACAGCATGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961661592 Original CRISPR CAAAGGGAACAGCATGCACC AGG Intergenic
No off target data available for this crispr