ID: 961662241

View in Genome Browser
Species Human (GRCh38)
Location 3:128475543-128475565
Sequence GGGTGCAAACAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961662231_961662241 -2 Left 961662231 3:128475522-128475544 CCATGGCCGGCAGCCCCACCGGG No data
Right 961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG No data
961662234_961662241 -8 Left 961662234 3:128475528-128475550 CCGGCAGCCCCACCGGGGTGCAA No data
Right 961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG No data
961662226_961662241 18 Left 961662226 3:128475502-128475524 CCGGGCAAGCCGAGCTGAGTCCA No data
Right 961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG No data
961662229_961662241 9 Left 961662229 3:128475511-128475533 CCGAGCTGAGTCCATGGCCGGCA No data
Right 961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961662241 Original CRISPR GGGTGCAAACAGAGGGAAGA AGG Intergenic
No off target data available for this crispr