ID: 961663029

View in Genome Browser
Species Human (GRCh38)
Location 3:128480471-128480493
Sequence AGCCAAAGCCAGAGTGGCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 345}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961663029_961663039 30 Left 961663029 3:128480471-128480493 CCGTGGCCACTCTGGCTTTGGCT 0: 1
1: 0
2: 0
3: 34
4: 345
Right 961663039 3:128480524-128480546 GAGGGAAGCCAGAGGAGAAGAGG 0: 1
1: 1
2: 20
3: 176
4: 1125
961663029_961663036 11 Left 961663029 3:128480471-128480493 CCGTGGCCACTCTGGCTTTGGCT 0: 1
1: 0
2: 0
3: 34
4: 345
Right 961663036 3:128480505-128480527 GGAGTTCGGCTATTTCAGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 56
961663029_961663038 22 Left 961663029 3:128480471-128480493 CCGTGGCCACTCTGGCTTTGGCT 0: 1
1: 0
2: 0
3: 34
4: 345
Right 961663038 3:128480516-128480538 ATTTCAGAGAGGGAAGCCAGAGG 0: 1
1: 0
2: 3
3: 32
4: 305
961663029_961663032 -3 Left 961663029 3:128480471-128480493 CCGTGGCCACTCTGGCTTTGGCT 0: 1
1: 0
2: 0
3: 34
4: 345
Right 961663032 3:128480491-128480513 GCTCAGCCCAGCCTGGAGTTCGG 0: 1
1: 0
2: 5
3: 22
4: 325
961663029_961663037 12 Left 961663029 3:128480471-128480493 CCGTGGCCACTCTGGCTTTGGCT 0: 1
1: 0
2: 0
3: 34
4: 345
Right 961663037 3:128480506-128480528 GAGTTCGGCTATTTCAGAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 79
961663029_961663031 -10 Left 961663029 3:128480471-128480493 CCGTGGCCACTCTGGCTTTGGCT 0: 1
1: 0
2: 0
3: 34
4: 345
Right 961663031 3:128480484-128480506 GGCTTTGGCTCAGCCCAGCCTGG 0: 1
1: 0
2: 2
3: 38
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961663029 Original CRISPR AGCCAAAGCCAGAGTGGCCA CGG (reversed) Exonic
900664831 1:3808174-3808196 AGCCAAGGTCAGGGTGGCTAGGG + Intergenic
903260344 1:22128480-22128502 AGCCAAAGACAGGGGGACCAGGG - Intronic
903461598 1:23524742-23524764 TACCAAAGCCAGTCTGGCCAAGG + Intronic
903545203 1:24119625-24119647 AGGCAAAGCCAGAGGGGTCTGGG - Intergenic
904295681 1:29518341-29518363 AGACAGAGCCAGACTGGCCCCGG - Intergenic
904705430 1:32386790-32386812 AGCCACGGCCAGCGTGGTCAAGG - Exonic
905620782 1:39444739-39444761 AGCCAGACCCAGAGTCGTCACGG - Exonic
906102474 1:43272324-43272346 AGCCAGAGGCAGAGAGGTCAGGG + Exonic
907247198 1:53115806-53115828 AGCCCAGGCCAGGGTGGCTAGGG - Intronic
907710672 1:56877542-56877564 AGGCAAAGACAGAGTGGCAGAGG - Intronic
909754333 1:79204679-79204701 AGCCAAAGCCAGACTAGGTAAGG + Intergenic
910661428 1:89678093-89678115 AGCTAAAGCCAGTGTGAACAAGG - Intronic
910988295 1:93027819-93027841 AGCAATAGCCAGACTGGCCCTGG + Intergenic
911620129 1:100057181-100057203 AGCCAAAGCCAAAGTGAGAATGG - Intronic
911733805 1:101315807-101315829 AGCCCAAGGCCGGGTGGCCATGG - Intergenic
911950806 1:104172207-104172229 AAGCACAGCCAGAGTGGACACGG - Intergenic
912074056 1:105850297-105850319 AGCTGGAGCCAGAGTGGCCAGGG - Intergenic
915106808 1:153539944-153539966 AGCCAGGGGCAGGGTGGCCAAGG - Intronic
915316116 1:155030038-155030060 AGCCCAAGCCAGGGAGGCCAGGG - Intronic
915570375 1:156742202-156742224 AGCCCAAGGGAGAGGGGCCAGGG + Intronic
916502542 1:165399265-165399287 AGCAAAACACAGAGTGGTCAGGG - Intergenic
917443017 1:175083469-175083491 GGCCAAAGTCAGTGTGGACAGGG + Intronic
917605540 1:176624946-176624968 AGCCAAGGACACTGTGGCCAAGG + Intronic
918082909 1:181221334-181221356 AGTCAAGGGCGGAGTGGCCAGGG + Intergenic
918560083 1:185855168-185855190 AGCAAGAGCCAGAGGGGGCAGGG - Intronic
920427716 1:205891464-205891486 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
920651319 1:207839546-207839568 AGCCAAATCCAGGATGGCCATGG + Intergenic
920725863 1:208434326-208434348 AGCAAAAGCCAGAGCAGGCAGGG + Intergenic
921168502 1:212525161-212525183 AGCCACAGTCAGACTGGCCAAGG - Intergenic
921227144 1:213031645-213031667 AGCTAAAGCTAAAGTGGCAAAGG - Intergenic
922985398 1:229862369-229862391 AGGCAAAGGCAGAGTGGGAAGGG + Intergenic
923869862 1:237979961-237979983 AGCAATAGACAGAGTGACCAAGG + Intergenic
1063375820 10:5553677-5553699 AGCCAGAGCCAGAGAGCACAAGG + Intergenic
1065913007 10:30326521-30326543 AGCCAGGGCCAAAGTGGTCAAGG + Exonic
1066285105 10:33958385-33958407 AACTAAAGCCATAGTGCCCAGGG + Intergenic
1067065143 10:43100147-43100169 ACCCAGAGCCAGAGTGTTCAAGG - Intronic
1067210294 10:44255265-44255287 AGGTACAGCCAGAGTGGCCCAGG + Intergenic
1068226826 10:54117159-54117181 AGCCAAAAGCAGAGTGGCAAAGG + Intronic
1069087244 10:64155403-64155425 AGTCAAGGCCAGAGTACCCAGGG - Intergenic
1069806276 10:71127008-71127030 AGCCACACCCAGAGAAGCCAAGG + Intergenic
1073202560 10:101748148-101748170 GTCCAAAGCCAGAGTGGTGAAGG + Intergenic
1075436575 10:122448595-122448617 ATCAAAAGCGAGAGTGGCCTAGG - Intergenic
1077217965 11:1402978-1403000 AGCAAAAGCCAGAGCCGCCGAGG + Intronic
1077322253 11:1947632-1947654 AGCCAAACCCATGGAGGCCACGG + Intronic
1077646935 11:3933560-3933582 AGACAAGGCCAAAGAGGCCATGG - Intronic
1078567985 11:12433736-12433758 TGCCAAACCCAGAGAGGCCGGGG - Intronic
1079031313 11:16988317-16988339 AGCCACATCCAGAGCAGCCAAGG + Intronic
1079878873 11:25897962-25897984 AGGCAAAGCCAAAGTGGAAAAGG - Intergenic
1079997110 11:27305906-27305928 AGCCAAATGCAGAGTGGCAAGGG - Intergenic
1080715654 11:34797524-34797546 AGCCATGGCTAGAGTGGCTAGGG - Intergenic
1080847617 11:36039889-36039911 AGCCAGAGTCAGGGTGGACAGGG + Intronic
1082078213 11:47991345-47991367 AGCCATAGCCAGAGTTGGCCAGG - Intronic
1083065976 11:59924310-59924332 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
1083760408 11:64813478-64813500 AACAAAAGCCAGACTGGGCACGG + Intergenic
1083926260 11:65808904-65808926 AGCCACAGCCTGGGTGGCCTGGG - Intergenic
1084173720 11:67412660-67412682 GGCAAAAGCCAGAGCAGCCAGGG + Intronic
1084630605 11:70346152-70346174 AGGCCAAGCCAGCGTGGGCAGGG - Intronic
1084878745 11:72154401-72154423 AGCCCAATCCAGAGCGGCAATGG - Intergenic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085533968 11:77207210-77207232 AGGCATAGCCAGAGGGGCCCGGG + Intronic
1087462449 11:98462631-98462653 AGCCATAGCTGGAGTGGCCAAGG - Intergenic
1089149689 11:116355221-116355243 AGCAGAAGCCAGAGAGGTCAGGG - Intergenic
1089357977 11:117867923-117867945 AGCCAAGGGCAGTGTAGCCAAGG + Intronic
1202805271 11_KI270721v1_random:2945-2967 AGCCAAACCCATGGAGGCCACGG + Intergenic
1092335487 12:7629073-7629095 AGACCCAGCCAGAGTGGACAGGG - Intergenic
1092446680 12:8564507-8564529 AGACCCAGCCAGAGTGGACAGGG + Intergenic
1093756782 12:22861730-22861752 ACCCATAGCCAGAGTATCCATGG - Intergenic
1095233985 12:39775595-39775617 ATCCAAAGCAAGCCTGGCCATGG + Intronic
1095909469 12:47411438-47411460 AGCCAAAGTCAGTGTGGGCAGGG - Intergenic
1096308256 12:50498040-50498062 AGCTAAAGCTAAAGTGGCAAAGG - Intergenic
1096362679 12:51001748-51001770 AGCCTAAGCCCCAGTGGTCAAGG + Intronic
1096450797 12:51739469-51739491 AGCTAAAGCTAAAGTGGCAAAGG - Intronic
1096814168 12:54191252-54191274 AGCCAATGTCAGAGGGGCCTGGG + Intergenic
1096979063 12:55718103-55718125 AGCCAAAGCCAGATTAGAAAGGG + Intronic
1096983551 12:55742873-55742895 AGTCAGAGCCAGAGAGACCAAGG - Intergenic
1097264449 12:57737634-57737656 AGCCAAAGCCGGCGGGGGCAAGG - Exonic
1101579922 12:106033300-106033322 AGCCCCAGACAGAGAGGCCATGG - Intergenic
1102044878 12:109823356-109823378 GGGCAAGGCCAGCGTGGCCACGG + Intronic
1102815163 12:115859477-115859499 CTCCAAAGCCAGACTGGCTAGGG + Intergenic
1102953854 12:117046946-117046968 TGCCAAAGCCAGAGGGGTCAGGG + Intronic
1103001224 12:117386701-117386723 AGACCAAGCCAGACCGGCCAAGG + Intronic
1104034877 12:125091326-125091348 AGCCAAGGTCAGAGTGGGAAGGG - Intronic
1104070213 12:125338221-125338243 CGCCTAAGCCACTGTGGCCAGGG - Intronic
1105655068 13:22427913-22427935 AGCCATAGCCAGAGAGCTCATGG + Intergenic
1105710757 13:23006872-23006894 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
1105924641 13:24996611-24996633 AGCCAAAGCCTGAAGAGCCAAGG + Intergenic
1106462198 13:29980975-29980997 AGCCAAAGCCAGATTGGGGTTGG + Intergenic
1106738166 13:32609454-32609476 AGCCAAAGACAGAGGGAACATGG - Intronic
1106792375 13:33168675-33168697 AGCCAAAGCTGGAGTGTACAGGG + Intronic
1107180320 13:37450932-37450954 AGACTAACCCAGATTGGCCAGGG - Intergenic
1108725337 13:53174764-53174786 AGCCAAGGGCAGAGAGGCTAGGG + Intergenic
1110846160 13:80192529-80192551 AGCCAGATCCGGAGTGGCAATGG - Intergenic
1110916813 13:81031017-81031039 AGACACAGCAAGGGTGGCCAGGG - Intergenic
1112327769 13:98454719-98454741 TGCCAAAACCACGGTGGCCATGG - Intronic
1112765609 13:102738921-102738943 AGACAAAGACAGAGTGGAAAAGG - Exonic
1113503219 13:110794362-110794384 AGCCAGACGCAGAGTGGCGAGGG - Intergenic
1113522595 13:110951315-110951337 AGAGAAAGCCAGAGTGCCCCTGG - Intergenic
1113984007 13:114299508-114299530 ATCCACAGCCAGAGGAGCCAGGG - Intronic
1115521934 14:34241721-34241743 AGCCAAAGCCAGATTGGGGTTGG - Intronic
1116561237 14:46381954-46381976 AGCCAAAGAAAGAGTGCCCTGGG - Intergenic
1117783034 14:59254624-59254646 AGCCAAACCCAAAGTGTCCTTGG - Intronic
1117843087 14:59881200-59881222 GGCACAAGCCAGGGTGGCCAAGG - Intergenic
1121632643 14:95432355-95432377 AGCCCAAGCCAGGTTGGCCATGG - Intronic
1121813513 14:96912150-96912172 AGGCAAGGCCAGAGTTGGCATGG - Intronic
1123690707 15:22836506-22836528 AACCAAAACCAGAGTGGTCAGGG + Intergenic
1123706618 15:22955481-22955503 AGCCACAGACAGAGTTGCCCCGG + Intronic
1123767982 15:23500788-23500810 AGCCACAGCCGGTGTGGCCCAGG - Intergenic
1123876839 15:24631864-24631886 AGCCACAGCCAGGTTGGCCTTGG + Intergenic
1124570305 15:30856779-30856801 AGCCACAGCCGGTGTGGCCAAGG + Intergenic
1125527407 15:40385983-40386005 GGCTCACGCCAGAGTGGCCAAGG + Intronic
1125725837 15:41867713-41867735 TGCCATACCCAGAGTGCCCATGG - Intronic
1128904811 15:71457431-71457453 AGCCCCAGCCAGAATGGGCAAGG - Intronic
1129330374 15:74824058-74824080 AGCCAAAGACAGGGTGAGCAGGG - Intronic
1129371837 15:75101522-75101544 AGCCTGAGCCCGAGAGGCCAGGG + Intronic
1129885196 15:79032393-79032415 AGCTACACCCAGAGAGGCCAGGG + Intronic
1130714071 15:86314429-86314451 TGCCAAAACCAGGCTGGCCATGG - Intronic
1131038203 15:89239510-89239532 AGCTAAAGCTAAAGTGGCAAAGG - Intergenic
1132886624 16:2185074-2185096 GGCCAGGGCCAGGGTGGCCAGGG - Intronic
1133688718 16:8192023-8192045 AGCCCAAGGCAGCATGGCCATGG + Intergenic
1133953971 16:10423681-10423703 AGCTAAAGCTAAAGTGGCAAAGG - Intronic
1134222178 16:12363381-12363403 AGCCTAATCCAGTGTGGTCAGGG - Intronic
1135892192 16:26367270-26367292 GGCCAAAGCCAGAATGGTCTGGG + Intergenic
1136390843 16:29963230-29963252 GGCCCAGGCCAGAGAGGCCAAGG - Exonic
1136402342 16:30025474-30025496 AGACACAGACACAGTGGCCACGG + Intronic
1136477341 16:30521713-30521735 AGGCAGAGGCAGAGTGGCCCTGG - Exonic
1137423352 16:48354823-48354845 AGCTAAAGCTAAAGTGGCAAAGG - Exonic
1138442355 16:57042632-57042654 GGCCAAAGCCAGAGGAGCCCAGG + Intronic
1139607887 16:68032931-68032953 AGGGAATGCCAGGGTGGCCAGGG + Intronic
1139848855 16:69938899-69938921 ACACAAAGCCAGGTTGGCCAGGG - Intronic
1140481393 16:75264802-75264824 AAACAAGGCCAGAGTGGACAGGG + Intronic
1141278518 16:82609285-82609307 GGGCAGAGCCGGAGTGGCCAGGG + Intergenic
1141617902 16:85220648-85220670 AGACAAAGCGAGACGGGCCAGGG - Intergenic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1143297231 17:5880444-5880466 AGCAAAGGGCAGAGTGGCCTGGG + Intronic
1143328313 17:6116132-6116154 GGACTAAGCCAGAGTGGACAGGG - Intronic
1143889074 17:10088490-10088512 AACAAGAGTCAGAGTGGCCAAGG - Intronic
1144647661 17:16986659-16986681 AGCCACAGCTGGGGTGGCCAAGG - Intergenic
1144786551 17:17835516-17835538 TGCCAACCCCAGGGTGGCCACGG + Intronic
1144876145 17:18398475-18398497 TGCAAGAGCCAGAGTCGCCATGG - Intergenic
1144949246 17:18985170-18985192 AGCCAAAGCCAGGATGGGAAGGG + Intronic
1147545685 17:41399585-41399607 AGCCAAAGCCACAGTGGAGATGG - Intergenic
1149635001 17:58159704-58159726 AACCAAGGCCAGAGAGGCCAGGG + Intergenic
1150281581 17:63932241-63932263 AGACAACGCCAGCCTGGCCATGG + Exonic
1152265326 17:79290843-79290865 TGTCAAGGGCAGAGTGGCCAGGG - Intronic
1153784111 18:8518956-8518978 TGCCACTTCCAGAGTGGCCATGG - Intergenic
1157425024 18:47577551-47577573 AACAAAAGCCAGAGTGGCAAAGG + Intergenic
1158922972 18:62214771-62214793 AGCCATAGATGGAGTGGCCAAGG + Intronic
1160056794 18:75490097-75490119 AGCCAAAGCCGTAAAGGCCATGG - Intergenic
1161749917 19:6088140-6088162 AGCCTAACCCAGGCTGGCCAGGG + Intronic
1161980230 19:7626445-7626467 AGCCTAACCCAGTGGGGCCAAGG - Intronic
1162642507 19:12022764-12022786 AGCTAAAGCTAAAGTGGCAAAGG + Intronic
1164060878 19:21672604-21672626 AGCTAAAGCTAAAGTGGCAAAGG - Intergenic
1164609815 19:29624327-29624349 GGACAAGGCCAGCGTGGCCAAGG + Intergenic
1165356840 19:35309777-35309799 AGGCAAGGCCAGTGTGGCCAAGG - Intronic
1165866225 19:38941040-38941062 AGCTAAAGCTAAAGTGGCAAAGG - Intronic
1165936741 19:39393882-39393904 AGCCTAGGCCAGAGTGGTTAGGG + Intronic
1166565900 19:43765408-43765430 AGTCAGAGGCAGAGTGGCCTTGG - Intergenic
1167096303 19:47376625-47376647 AGCCCCAGCCAGAGGGGCCTGGG - Intronic
1167424665 19:49423771-49423793 GGACAAAGACAGAGTGGCCGAGG + Exonic
1167680356 19:50916479-50916501 AGCCTCAGCCAGAGAAGCCAGGG + Intergenic
1167850229 19:52195616-52195638 ACCCAAAGGCAGGGTGGTCATGG - Intronic
925607550 2:5673785-5673807 AGCCAAAAACAGAGGGGCCGGGG + Intergenic
926297743 2:11580879-11580901 GGCCAAGGCCAGAGGGGGCATGG + Intronic
927607847 2:24504324-24504346 GGCCAAAGCCACAGTAACCAAGG - Intronic
927670413 2:25064143-25064165 AGCCAGGGCCAGGGTGGTCACGG - Intronic
930053575 2:47235429-47235451 GGCCAGAGCCAGAGAGCCCATGG - Intergenic
930183190 2:48385295-48385317 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
930918170 2:56719777-56719799 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
932777841 2:74539126-74539148 ACCCAAACCCCGAGTGGTCAGGG - Intronic
935602907 2:104940661-104940683 AACGAAGGCCCGAGTGGCCAAGG + Intergenic
935823330 2:106916080-106916102 GGCCATAGCCAGACTGGCCTTGG - Intergenic
936398368 2:112147581-112147603 AGCCAAATGCAGAGAGGCCGGGG - Intronic
937429431 2:121825938-121825960 AGACAAAGCTAGAGAGGCCCAGG + Intergenic
937841248 2:126526726-126526748 ATCTTAAACCAGAGTGGCCAGGG + Intergenic
938647059 2:133342504-133342526 AGCCAGAGTCAGAGAGGCCTGGG + Intronic
941525676 2:166603769-166603791 ATCCATATCCAGAGTGTCCATGG + Intergenic
942870832 2:180732488-180732510 AACCATAGCTAGGGTGGCCAAGG - Intergenic
944234818 2:197432501-197432523 AGCATAAGCCACATTGGCCAGGG + Intronic
944891425 2:204121043-204121065 AGGCAAGGCAAGAGTGGCCTAGG - Intergenic
945274787 2:207977315-207977337 AGCTAAAGGCAGAGTCACCATGG - Exonic
945782623 2:214195241-214195263 AGGAAAAGGCAGAGTGACCAGGG + Intronic
946083773 2:217150658-217150680 GTCCAAATCCAGAGTGGCCCAGG + Intergenic
946164149 2:217853630-217853652 AGACAAAGACAGTGGGGCCATGG - Intronic
946171433 2:217898288-217898310 AGCCAGGGCCAGACTGGCCCAGG + Intronic
946603513 2:221376837-221376859 AGCCACAGCAAGACTGTCCAAGG - Intergenic
947009606 2:225551215-225551237 GGCCAAAGCCAGAGTGGACGTGG - Intronic
947315301 2:228851230-228851252 AGCCAAAGAGAGAGAGGCCTGGG + Intronic
947787805 2:232839901-232839923 AGCCAACGACAGCGTGGCCTGGG - Exonic
947983245 2:234427419-234427441 GGCCAGAGCTGGAGTGGCCAAGG + Intergenic
948492522 2:238322204-238322226 AGCCACAGCTAGAGTGGGCTGGG - Intronic
948678387 2:239612363-239612385 AGCCATGGCCAGCGTGGCCCTGG - Intergenic
1169209319 20:3756931-3756953 AGCAAAAACCAGTGTGGACACGG + Intronic
1169996950 20:11569210-11569232 AGCCAAAGCCACAGAGAGCAGGG - Intergenic
1170029434 20:11929688-11929710 AGTGAAGGCCAGAGGGGCCAGGG + Intergenic
1171181923 20:23097308-23097330 AGGCAAAGCCAGAATGCCCGGGG + Intergenic
1172168546 20:32914183-32914205 AGCCACACCTAGAGTGGTCAAGG + Intronic
1173066897 20:39721797-39721819 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
1173866876 20:46317888-46317910 AGCCAGAGCCAGACCTGCCAGGG - Intergenic
1175205007 20:57304537-57304559 ACCCAAAACCATGGTGGCCAAGG - Intergenic
1175394489 20:58649585-58649607 ATCCAAAGACAGAGAGGCCCTGG - Intergenic
1175395537 20:58657040-58657062 AGCCAACACCAGAGTGGCCCAGG - Intronic
1177516506 21:22158594-22158616 AGCCACAGCTGGGGTGGCCAAGG + Intergenic
1178700296 21:34827693-34827715 AGCCACAGCTGGGGTGGCCAAGG - Intronic
1179005545 21:37510959-37510981 AGCATCAGCCAGAGTGGTCAGGG + Intronic
1179240034 21:39581757-39581779 TGACAAAACCAGAGTAGCCAGGG - Intronic
1181738204 22:24898486-24898508 AGTCACAGCCAGAGAAGCCAGGG - Exonic
1182098674 22:27642645-27642667 ATACCAAGCCAGCGTGGCCAGGG + Intergenic
1182281495 22:29220140-29220162 AGACAAAGCCAGTGTGGGCAGGG - Intronic
1182855679 22:33515855-33515877 AGCCAAAGGGTGAGAGGCCAAGG - Intronic
1183403205 22:37616883-37616905 ACACAGAGCCAGAGTCGCCACGG - Intronic
1183583900 22:38741006-38741028 AGCTGAAGTCAGAGTGGCAAAGG - Exonic
1183695571 22:39420015-39420037 AGGCGAAGCCAGAGTTGGCATGG + Intronic
1183878811 22:40808380-40808402 GCCCAAAGCCAGAGTGGCAGAGG + Intronic
1184714413 22:46272846-46272868 GGCCTCATCCAGAGTGGCCAGGG + Intronic
1185124984 22:49004960-49004982 GGGCAAAGCCGGAGGGGCCAAGG - Intergenic
1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG + Intergenic
1185153914 22:49182028-49182050 AGCCATCGGCAGAGGGGCCATGG - Intergenic
1185244321 22:49765237-49765259 AGGCAAGGTCAGAGTGGCCGAGG - Intergenic
950327034 3:12120550-12120572 AGACACAGCCAGACTGGCTAAGG - Intronic
951270673 3:20619687-20619709 AGCTAAAGCTAAAGTGGCAAAGG - Intergenic
953802834 3:46040656-46040678 AGCCAAAGACACAGTTGACAAGG - Intergenic
954155736 3:48684111-48684133 AGCCAAAGCCAGAGTGTGGGGGG + Intronic
954216188 3:49125762-49125784 GGCCAAAGCCATAGTAGCCAGGG + Exonic
954231313 3:49219915-49219937 AGCTAAAGCTAAAGTGGCAAAGG + Intronic
955201656 3:56857203-56857225 AGCCACATCTACAGTGGCCACGG + Intronic
955522413 3:59787831-59787853 AGGCAGAGCCAGAGAGGCCTAGG - Intronic
955865814 3:63382673-63382695 AGAAAAAGGCAGATTGGCCAGGG - Intronic
957671410 3:83307327-83307349 AACCAAAGCCATAGTGGTCTGGG - Intergenic
959197908 3:103209713-103209735 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
959302631 3:104622356-104622378 AGCCAAAGCTAGATTGGCCTTGG - Intergenic
960210212 3:114955715-114955737 AGCCAAAGTCAGAGAGGTGATGG - Intronic
961663029 3:128480471-128480493 AGCCAAAGCCAGAGTGGCCACGG - Exonic
963132143 3:141868168-141868190 AGCCAAAACCACAGTAGCTATGG - Intergenic
965315302 3:167183133-167183155 AGCTAAAGCTAAAGTGGCAAAGG - Intergenic
966933747 3:184692083-184692105 AGCCACAGCCAATGGGGCCAGGG - Intergenic
967427226 3:189340910-189340932 ATCCAGAGACAGAGAGGCCATGG - Intergenic
972080209 4:35140520-35140542 AGCCAAAGCTAAAGCGGCAAAGG + Intergenic
973008435 4:45042830-45042852 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
973684978 4:53360538-53360560 TGATAAAGCCAGAATGGCCAGGG - Intronic
974635839 4:64563372-64563394 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
975381470 4:73705208-73705230 ACCCAATCTCAGAGTGGCCATGG + Intergenic
977626042 4:99190739-99190761 AGCTAAAGCTAAAGTGGCAAAGG - Intergenic
977641994 4:99367829-99367851 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
977846994 4:101778372-101778394 GGCCATAGCCAGACTGGCCTTGG + Intronic
979982760 4:127276688-127276710 AGCTAAAGCTAAAGTGGCAAAGG - Intergenic
980283484 4:130752978-130753000 TGCCAAAGGCAGAGTGGACCTGG + Intergenic
981197738 4:141940822-141940844 AGCTAAAGCTAAAGTGGCAAAGG - Intergenic
982242574 4:153315056-153315078 AGACAGAGGCAGAGTGACCAGGG + Intronic
982282059 4:153693631-153693653 AGCTAAAGCTAAAGTGGCAAAGG - Intergenic
985674942 5:1226109-1226131 AACCAAAGCCAGGGAGGCGAGGG - Intronic
985845162 5:2339108-2339130 AGACTGAGCCAGAGAGGCCAAGG + Intergenic
986232965 5:5883811-5883833 AGTCAAAGCCAGGGAGACCAGGG - Intergenic
986458435 5:7944006-7944028 AGGCCGAGCCAGTGTGGCCATGG + Intergenic
987173883 5:15287028-15287050 AGGCAAAGTCAGTGTGGCCATGG - Intergenic
988811151 5:34786457-34786479 AGCTAAAGCTAAAGTGGCAAAGG - Intronic
989758705 5:44987009-44987031 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
990307132 5:54504630-54504652 AGCTAAAGCCAAAGTGGCAAAGG - Intergenic
990776293 5:59309338-59309360 AGCCAGAGCCAGAGGTGCAAGGG - Intronic
990926399 5:61029969-61029991 AGCAAAAGCCTGGGTGACCATGG + Intronic
992614486 5:78535511-78535533 ACACAAAGCCAGAGCAGCCAGGG + Intronic
993405843 5:87511107-87511129 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
993705606 5:91166454-91166476 TGCCAAAGTCAGGGTGTCCAAGG - Intergenic
997363152 5:133308104-133308126 AGTTAAAGCTGGAGTGGCCAAGG - Intronic
998092779 5:139380822-139380844 AGCCAAAGCCATACTGGCTCTGG - Exonic
998205359 5:140153544-140153566 AGCCAAAGTGTGCGTGGCCACGG + Intergenic
999393137 5:151208825-151208847 AGCAGAAGCCAGAGTGGGAAGGG - Intronic
1002005939 5:176235164-176235186 AGACAAATCCAGGATGGCCAAGG + Intergenic
1002220440 5:177675468-177675490 AGACAAATCCAGGATGGCCAAGG - Intergenic
1002442124 5:179269955-179269977 TGCCAAGGCCAGCATGGCCAGGG + Intronic
1002936885 6:1681609-1681631 AGCCCCAGGCAGAGAGGCCAGGG + Intronic
1003464284 6:6363688-6363710 AGCCAATGGCAGCCTGGCCATGG - Intergenic
1005272593 6:24181931-24181953 AACCAAAACCAGAGTGGTCCTGG + Intronic
1006577542 6:35057311-35057333 TGACAGAGCCAGAGTGGCCTGGG - Intronic
1007118145 6:39358481-39358503 AGCGAAAGCCAGAGTAGGCAAGG - Intronic
1007606606 6:43122297-43122319 AGGCCAAGCCAGAGGGCCCAGGG - Intronic
1008733309 6:54509962-54509984 AGACAAAGGCAGACTGGCTAGGG - Intergenic
1009062934 6:58418910-58418932 AGCTAAAGCTAAAGTGGCAAAGG - Intergenic
1009250614 6:61293457-61293479 AGCTAAAGCTAAAGTGGCAAAGG - Intergenic
1009906819 6:69879583-69879605 ATCCAAAGCCAAAGTTTCCAAGG - Exonic
1011408690 6:87043231-87043253 AGCCAAAAGAAGAGTGACCAGGG - Intergenic
1011672292 6:89694941-89694963 ATCCAAATCCAGGCTGGCCATGG + Intronic
1012101012 6:95085097-95085119 AGCCAGACCCAGAGCGGCAACGG - Intergenic
1013174029 6:107662288-107662310 AGCAAAAGCCAGAGTTGGGAGGG - Intergenic
1013475131 6:110499955-110499977 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
1013768446 6:113599702-113599724 AGACTCAGGCAGAGTGGCCAGGG - Intergenic
1014770604 6:125454172-125454194 AGCCATATGCAGAGTGGCAAGGG - Intergenic
1015600059 6:134903110-134903132 AGCCATAGACCGAGGGGCCAAGG + Intergenic
1016001277 6:139043955-139043977 AGTGAAAGCCACAATGGCCAGGG + Intergenic
1016209164 6:141507139-141507161 AGCAAAAGCCTGAGGGACCAGGG - Intergenic
1016210946 6:141532371-141532393 AGCCAAGTGCAGAGTGGCAAGGG - Intergenic
1017610390 6:156179770-156179792 AGCCAAAACCAAGATGGCCATGG - Intergenic
1017654453 6:156614102-156614124 AGCCCAAGCTAAAGGGGCCAAGG - Intergenic
1017987867 6:159460436-159460458 AGCCAAAGCCACCGTGGCCTAGG + Intergenic
1018883105 6:167904742-167904764 AGCCTAAGCCAGAGAGGCAGAGG - Intronic
1019267326 7:125185-125207 AGGCAGAGTCAGAGAGGCCACGG - Intergenic
1019922822 7:4173785-4173807 AGCCACAGCCTGGATGGCCAGGG + Intronic
1021431005 7:20559428-20559450 AGCCACATGCAGAGTGGCGAGGG + Intergenic
1021524972 7:21577012-21577034 AGAAAAAGGCAGAGTGGCTAAGG + Intronic
1023752939 7:43389069-43389091 AACAAAAGCCTGTGTGGCCAAGG + Intronic
1023844822 7:44114656-44114678 TCCCATAGCCAGAGTGCCCAGGG + Intergenic
1023964158 7:44953354-44953376 AGCCACAGCTGGGGTGGCCAAGG + Intergenic
1024210678 7:47200663-47200685 AGCCATAGCAGGGGTGGCCAAGG + Intergenic
1024312696 7:47984006-47984028 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
1024338272 7:48231489-48231511 GGCCAAAACACGAGTGGCCATGG + Intronic
1024722308 7:52150731-52150753 AGGCAAAGTCAGAGTAGCAAGGG + Intergenic
1024889666 7:54185595-54185617 AGCCACAGCCACAGTGGCAAAGG + Intergenic
1025813794 7:64891421-64891443 AGCCAGAACCAGAGGGGCCTAGG + Intronic
1025818924 7:64945511-64945533 AGCCAGAACCAGAGGGGGCAGGG - Intergenic
1026262558 7:68767987-68768009 AACCAAAGCAAGAGATGCCATGG + Intergenic
1026262626 7:68768776-68768798 AACCAAAGCAAGAGATGCCATGG + Intergenic
1026914604 7:74112319-74112341 AGCCCATGGCAGAGTGGCCATGG + Intronic
1028780339 7:94728513-94728535 AGCTAAAGCTAAAGTGGCAAAGG - Intergenic
1029196521 7:98809405-98809427 AGCCAATGCAAGCGTGGCAAAGG + Intergenic
1029312191 7:99677728-99677750 TGCCAAAGCCAGGGTGGCCTTGG + Intronic
1029347349 7:99988027-99988049 CCTCACAGCCAGAGTGGCCATGG - Intergenic
1029802060 7:102958755-102958777 AGACAAAGCAAGAATGGCCTTGG + Intronic
1031594795 7:123637581-123637603 AGCCAGAGACAGAGTGTCCAGGG - Exonic
1032074329 7:128829458-128829480 AGCCCCAGCCAGAGCAGCCAGGG - Intergenic
1033032874 7:137844800-137844822 AGACAAAGCCAGAGTTTGCAAGG - Intronic
1033243640 7:139701309-139701331 AGCCAGGGACAGAGAGGCCACGG + Intronic
1034926937 7:155130053-155130075 TGCCAAAGCCAGCGTGGCTGCGG + Intergenic
1035524706 8:303581-303603 AGCCAAAGCCTAATGGGCCAGGG + Intergenic
1035972811 8:4270394-4270416 AGCCAAGGCAAGTGTGGCCGAGG - Intronic
1036637167 8:10559342-10559364 AGCAGGTGCCAGAGTGGCCAAGG + Intergenic
1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG + Intronic
1037567982 8:20133726-20133748 AGCCAAAGCCAGTGTGTGTAAGG + Intergenic
1038733792 8:30151101-30151123 AGCTAAAGCTAAAGTGGCAAAGG - Intronic
1039658192 8:39433359-39433381 AGCCTAAGCCTGAGTTCCCATGG + Intergenic
1040092342 8:43410782-43410804 TGCTACAGCCTGAGTGGCCAGGG - Intergenic
1040608906 8:48963065-48963087 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
1041018843 8:53617846-53617868 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
1041674161 8:60521275-60521297 AGGCACCGCCAGAGTGGGCATGG + Intronic
1041720627 8:60972098-60972120 AGACAGAGACAGAGAGGCCAAGG - Intergenic
1042468977 8:69161740-69161762 AGACAAAGGCAGAGAGGCAATGG - Intergenic
1043024087 8:75044833-75044855 AGCCAAATCTAAAGTGGCAAAGG + Intergenic
1043598836 8:81915660-81915682 CGCCTAAGCCACAGTGGTCAGGG + Intergenic
1047405031 8:124578179-124578201 AGCCAGAGGCTGAGTAGCCAGGG + Intronic
1047690148 8:127343800-127343822 AGCCATAGACAATGTGGCCAAGG + Intergenic
1048655309 8:136530148-136530170 ACACACAGACAGAGTGGCCATGG - Intergenic
1049003357 8:139839785-139839807 ATCCAAAGGGAGAGTGGGCATGG + Intronic
1049230772 8:141480101-141480123 AGGCCAAGCCAGTGTGGTCAGGG - Intergenic
1049335425 8:142082038-142082060 AACTAAAGCCAGAGGAGCCATGG + Intergenic
1049573063 8:143378573-143378595 AGGCAAAGCCAGTGGGGCCCTGG - Intronic
1049827299 8:144677565-144677587 AGCCAAATACAGTGCGGCCATGG + Intergenic
1050039063 9:1469287-1469309 ACAGGAAGCCAGAGTGGCCACGG - Intergenic
1050694613 9:8264744-8264766 AACCAAAGACAGAGAAGCCAAGG - Intergenic
1051679875 9:19596110-19596132 TGCAAAAGCCAGAGTGGAGAGGG + Intronic
1052100919 9:24445521-24445543 GGCCATAGCCAGATTGGCCATGG + Intergenic
1053131570 9:35618511-35618533 GGCCAGGGCCAGAGGGGCCACGG + Intronic
1053164080 9:35832492-35832514 AGCCATCCCCACAGTGGCCAGGG - Intronic
1057818571 9:98314163-98314185 AACTAAAGTCAGAGTGGCCAGGG + Intronic
1058741466 9:107946916-107946938 AGTCATAGCCAGAGTTGCCATGG + Intergenic
1059569605 9:115420514-115420536 AGCCAAAGCAAGAGTGTGCATGG - Intergenic
1059785477 9:117578362-117578384 AGCCACAGCTAGGATGGCCAAGG - Intergenic
1062030376 9:134359518-134359540 AGGCAAAGCCACAGTGCCCCAGG - Intronic
1186626963 X:11304706-11304728 TGCCAATGCCAGAGTGACAAGGG - Intronic
1187360559 X:18623100-18623122 AACCAAAGCCAGATTTCCCAAGG - Intronic
1191149736 X:57208255-57208277 AGCTAAAGCTAAAGTGGCGAAGG - Intergenic
1191833818 X:65443055-65443077 AGCTAAAGCTAAAGTGGCAAAGG - Intronic
1192037502 X:67580657-67580679 AGAAAAAACCAGAGTGGTCAGGG - Intronic
1192249425 X:69399054-69399076 AGCCACAGCTAGGGTGGTCAAGG + Intergenic
1193733075 X:85125001-85125023 AACCAAAGCCAGACTGTCCCGGG + Intergenic
1194536254 X:95108477-95108499 AGCTAAAGCTAAAGTGGCAAAGG - Intergenic
1196471699 X:116035985-116036007 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
1197034797 X:121860290-121860312 AGCCACAGCTGGAATGGCCAAGG + Intergenic
1197387037 X:125814451-125814473 AGTCAAAGGCAAAGTGGGCATGG - Intergenic
1199288805 X:146083307-146083329 TGCCAAAGTCAGAGTGTCCTCGG - Intergenic
1199719950 X:150536318-150536340 AGCCACAGAGAGAGTTGCCAGGG + Intergenic
1199937869 X:152594764-152594786 AGCTAAAATCAGAGTGGCAAGGG + Intergenic
1199997195 X:153032892-153032914 AGCCGTGGCCAGAGTGGCCTTGG + Intergenic
1200077784 X:153560251-153560273 ACCCAGCCCCAGAGTGGCCACGG + Intronic
1200117308 X:153775000-153775022 AGCCCAAGCCTGAGGGGCCAGGG + Exonic
1201370026 Y:13253299-13253321 AGCTAAAGCTAAAGCGGCCAAGG + Intronic
1201926533 Y:19293834-19293856 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
1202140228 Y:21713786-21713808 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
1202169861 Y:22031907-22031929 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
1202221505 Y:22554466-22554488 AGCTAAAGCTAAAGTGGCAAAGG - Intergenic
1202321612 Y:23641196-23641218 AGCTAAAGCTAAAGTGGCAAAGG + Intergenic
1202549155 Y:26028860-26028882 AGCTAAAGCTAAAGTGGCAAAGG - Intergenic