ID: 961664590

View in Genome Browser
Species Human (GRCh38)
Location 3:128487840-128487862
Sequence GGTAGAGTGCGCCTCGGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961664574_961664590 29 Left 961664574 3:128487788-128487810 CCCAGGGACAGCACGTCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 961664590 3:128487840-128487862 GGTAGAGTGCGCCTCGGCCTCGG 0: 1
1: 0
2: 0
3: 7
4: 62
961664576_961664590 28 Left 961664576 3:128487789-128487811 CCAGGGACAGCACGTCCGGAGGC 0: 1
1: 1
2: 0
3: 7
4: 118
Right 961664590 3:128487840-128487862 GGTAGAGTGCGCCTCGGCCTCGG 0: 1
1: 0
2: 0
3: 7
4: 62
961664581_961664590 13 Left 961664581 3:128487804-128487826 CCGGAGGCTGGCGGGGCTTACAG 0: 1
1: 0
2: 0
3: 5
4: 148
Right 961664590 3:128487840-128487862 GGTAGAGTGCGCCTCGGCCTCGG 0: 1
1: 0
2: 0
3: 7
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961664590 Original CRISPR GGTAGAGTGCGCCTCGGCCT CGG Intronic