ID: 961665014

View in Genome Browser
Species Human (GRCh38)
Location 3:128489251-128489273
Sequence CCGGGCGCCCCCGGAGCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961665014_961665023 -4 Left 961665014 3:128489251-128489273 CCCTCGGCTCCGGGGGCGCCCGG 0: 1
1: 0
2: 2
3: 15
4: 163
Right 961665023 3:128489270-128489292 CCGGCTGGGCCCAGCTCCGCGGG 0: 1
1: 0
2: 5
3: 18
4: 277
961665014_961665021 -5 Left 961665014 3:128489251-128489273 CCCTCGGCTCCGGGGGCGCCCGG 0: 1
1: 0
2: 2
3: 15
4: 163
Right 961665021 3:128489269-128489291 CCCGGCTGGGCCCAGCTCCGCGG 0: 1
1: 1
2: 6
3: 21
4: 328
961665014_961665027 21 Left 961665014 3:128489251-128489273 CCCTCGGCTCCGGGGGCGCCCGG 0: 1
1: 0
2: 2
3: 15
4: 163
Right 961665027 3:128489295-128489317 CGCCCCCGTCACCCCCTCCCAGG 0: 1
1: 2
2: 5
3: 57
4: 540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961665014 Original CRISPR CCGGGCGCCCCCGGAGCCGA GGG (reversed) Intronic
900193194 1:1360076-1360098 CCGGGCCCTCCCAGACCCGAGGG - Intronic
900513465 1:3070724-3070746 CCGGGCGGGCCCCGAGCCGAGGG - Intronic
900607692 1:3531182-3531204 CCAGGCCCCCCAGGAGCCCAAGG + Intronic
901007910 1:6180504-6180526 CCGCGCGCCCGCGGACCCGACGG + Intergenic
901251761 1:7784463-7784485 CCGGGGGCCCCCAGTACCGAGGG - Intronic
903543969 1:24112105-24112127 CCCGGTGCCCGCTGAGCCGAGGG - Exonic
905974200 1:42163538-42163560 CCAGGAGCCCCAGGAGCCCAGGG - Exonic
907682635 1:56578757-56578779 CGGGGGCCCCCCGGAGCTGACGG + Intronic
919991054 1:202709090-202709112 CTGGGCGCCCCCAGATCCTAAGG + Intronic
1065636728 10:27742526-27742548 CGGGGCGCCCGGGGAGCCGCCGG + Intronic
1066022709 10:31319345-31319367 CGGGGCGCCCCCGGGGGTGAGGG + Intronic
1073043236 10:100621484-100621506 GGGGGCCCCCCCAGAGCCGAGGG - Intergenic
1073290074 10:102409139-102409161 CCGGGCGGCCCGGGGGCCGAGGG - Intronic
1075587158 10:123666312-123666334 CCGGGCGGCGGCGGCGCCGAGGG + Intergenic
1077464909 11:2729124-2729146 CTGGGCTCTCCCGGGGCCGAGGG + Intronic
1078067938 11:8090136-8090158 ATGGGCGGCCCCGGAGCCGGCGG + Exonic
1081831986 11:46121726-46121748 CCGAGCGTCCCGGGAGCCGCGGG - Intergenic
1083232609 11:61332819-61332841 CCGGCCGCCCCCGGGGCGGCGGG + Intronic
1083457135 11:62786814-62786836 CCGGGCGGCCGCGGAGCCGTGGG - Exonic
1084387745 11:68854790-68854812 CAGGGCGCCCGCGCAGCCGCGGG + Intergenic
1084529633 11:69719243-69719265 CCAGGCACCCCGGGAGCCGATGG + Intergenic
1085387079 11:76163593-76163615 CTGGGCTCCCCCAGAGCGGAGGG + Intergenic
1086064866 11:82733664-82733686 CGGGGAGCCCCCGAAGCCGAAGG + Exonic
1091718529 12:2795879-2795901 CCCGGCCTCCCCGGGGCCGAGGG - Intronic
1097218273 12:57430846-57430868 CGGGGCTTCCCCGGGGCCGAGGG + Exonic
1097307743 12:58087886-58087908 GCAGGCGCCCCGGGAGCCCAGGG + Intergenic
1103364014 12:120369333-120369355 CCGGGCGCCCGCGGAGGCGGCGG + Intergenic
1103764749 12:123271933-123271955 CCGAGCGCACCCGGAGGCGCGGG - Exonic
1104887136 12:132117328-132117350 CACGGAGCCCCCGGAGCAGAGGG + Intronic
1105943541 13:25171183-25171205 CCGGGGCCCCCCAGAGCCGCAGG - Exonic
1107549036 13:41457954-41457976 CCGGGCGCGCGCGGAGCTGGTGG - Intronic
1110450822 13:75636199-75636221 CCGGGAGCCCGGGGAGCCAAGGG + Intronic
1112580633 13:100674379-100674401 CCGGGCGCACCCGGCGCCTGCGG - Intronic
1113422830 13:110183219-110183241 CCAGGCCCCCCTGGAGCAGAAGG - Exonic
1114525534 14:23365337-23365359 CGGGGCGCCCCCGCGGCCTAGGG - Exonic
1122162232 14:99793147-99793169 CCGGGCGGCCTGGGAGCCGCAGG - Intronic
1122329881 14:100904871-100904893 CCAGGCGCCCAGGAAGCCGAGGG + Intergenic
1122447708 14:101781620-101781642 CCGGCCGCCTCCGGAGCCTCCGG + Intronic
1122808920 14:104278121-104278143 CCAGGCCCTCCCGCAGCCGAGGG - Intergenic
1123699077 15:22901472-22901494 CGGGGCGCACCTGGAGCCCAAGG - Intronic
1128322628 15:66703696-66703718 CGGGGCGGCCCTGGAGCCGGCGG + Exonic
1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG + Exonic
1129082270 15:73052031-73052053 GCGGGGGCGCGCGGAGCCGAGGG + Intronic
1129082331 15:73052226-73052248 CGGGCCGCGCGCGGAGCCGAGGG + Intronic
1132932972 16:2468139-2468161 CCGGGGGCGCCCTGAGCCGCGGG + Intergenic
1133224593 16:4334859-4334881 CAGGGCCCCCCCGGAGCCGAGGG - Exonic
1135023846 16:18984165-18984187 CCGTGCGCCCTCGGACCCCAGGG - Intronic
1135821993 16:25692769-25692791 CCAGCCGCCCCCGGGACCGACGG + Exonic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1136540222 16:30924379-30924401 CCCGGCCCCCCCGCCGCCGATGG + Intronic
1137683162 16:50368639-50368661 CCGGGCCGCCCCGGAGCCACTGG + Intronic
1138572423 16:57884340-57884362 CCGGACGCCCCCCGAGCCCCCGG - Exonic
1139548475 16:67660775-67660797 CCGCGCGCCCCCGGAGTCTGGGG - Exonic
1139664912 16:68448555-68448577 CCTCGCGCCGCCGGAGCCAATGG + Exonic
1141608443 16:85168781-85168803 GCGGGCGCCCCTGGAGGCGGAGG - Intergenic
1142429733 16:90019535-90019557 CCCGGCGCCCCCCCAGCCGCAGG + Intronic
1142764683 17:2058527-2058549 CCCGGCGTCCCCGGCCCCGACGG + Exonic
1143340601 17:6207948-6207970 CAGGGCGGCCCCGGAGCTCAGGG - Intergenic
1146547067 17:33748976-33748998 CCGAGGGCCCCCTGAGCCCAGGG - Intronic
1148452659 17:47790103-47790125 CCGGGCTCCCCCAGAGCTGGCGG - Intergenic
1148849288 17:50547118-50547140 CCGGGCACCTACGGAGCCGCGGG - Exonic
1149891345 17:60392426-60392448 CCGGGCGCCTCCGCTGGCGACGG + Intronic
1150692334 17:67377366-67377388 CACGGCGCCCGGGGAGCCGAGGG + Intronic
1151156135 17:72123925-72123947 GCAGGCGCCCCCGCAGCCGCAGG + Exonic
1151343147 17:73484713-73484735 CCTGGGGCCCCCAGAGCTGAAGG - Intronic
1152708832 17:81860209-81860231 CCCGGCGCGCCCGGAACTGAAGG - Intronic
1152751771 17:82065644-82065666 CCCGGCGCCCTCGGAGCCAAAGG - Intronic
1152781540 17:82229218-82229240 CCGGGCGCCCCCGGACCTGATGG - Intronic
1152924612 17:83081211-83081233 CCGGGAGCCTCCGAGGCCGACGG + Intronic
1153514320 18:5890743-5890765 CGGGGCGCGCCGGGAGCCGGAGG - Exonic
1153643537 18:7175135-7175157 CCGGGCATCCCAGGAGCTGAGGG + Intergenic
1154097553 18:11432312-11432334 CCTGGCGCCCTCGGAGCAGGGGG + Intergenic
1157529542 18:48409509-48409531 CTGTGCGCCCCCCGAGCCGGCGG - Intronic
1157848999 18:51030351-51030373 CTGGGCGGCCGCGGAGCCTAGGG - Exonic
1158976718 18:62716493-62716515 GCTGGCGCCCCCGGAGCCGCGGG + Exonic
1160147953 18:76379472-76379494 CCGGGCGCCCACAGAGCGCAGGG + Exonic
1160500866 18:79400584-79400606 CCCGGCGCGCCCGGGACCGAGGG + Intronic
1160996276 19:1883531-1883553 CCTGGAGACCCCGGAGACGAAGG + Intronic
1161581241 19:5082211-5082233 CCTGGAGCCCCTGGAGCCGCTGG + Intronic
1162070355 19:8149128-8149150 GGGGGCGCCCCCGGAGCCCGCGG + Intronic
1162951351 19:14073576-14073598 CCGGTCGCCGCCGCAGCCGCTGG + Exonic
1163118324 19:15200941-15200963 CGGGACGCGCCCGGAGCCCAGGG - Exonic
1163473619 19:17512188-17512210 CCAGTGGCCCCCGTAGCCGAGGG - Intronic
1164492453 19:28727504-28727526 CCGGGCGCCCCCCGAGGGGCCGG + Intergenic
1166765598 19:45251151-45251173 CCCGGAGCCCCCGGAGCCCCCGG + Intronic
1167075205 19:47244255-47244277 CCGGGCGCCTCCGGAAGCCACGG - Intergenic
925310418 2:2877797-2877819 CCCGGCTCCCACGGAGCAGACGG + Intergenic
928964846 2:36966396-36966418 CCGGGCGCCGGCGGTGCCAAGGG - Exonic
932887457 2:75560635-75560657 CCGGGCGCCCCCAGAGTTCAGGG + Intronic
940883186 2:158967979-158968001 CCGGGCGTCCCTGGGGCCGCGGG - Intergenic
941367081 2:164621737-164621759 CTGGGCGGCCCCGGCGCCGCTGG + Exonic
943692344 2:190881373-190881395 CCGGGCGCCGCCGGGGCAGCGGG - Exonic
948910236 2:240999060-240999082 CCGGGCGCCCCGCGAGCCCGGGG - Intronic
1172962206 20:38806871-38806893 CCGGGCACCTCAGGAGCGGAGGG + Intronic
1173803927 20:45911902-45911924 CCGGGAGACCCGGGAGCCCACGG - Exonic
1175981178 20:62739442-62739464 CCTGGGGCCCCCTGAGCCCAGGG + Intronic
1176151903 20:63595795-63595817 CAGGTCGGCCCCAGAGCCGAAGG + Intronic
1176168988 20:63688695-63688717 GCGGGAGCCGCCGGAGCCCATGG - Intronic
1177187968 21:17819108-17819130 CCGCGCGCCCCCAACGCCGAAGG - Intronic
1177387409 21:20425883-20425905 CCGGGAGCCCCTGGAGAAGAAGG - Intergenic
1179375506 21:40846925-40846947 CCGGGGGCCCACTGAGCTGACGG - Exonic
1184060740 22:42079608-42079630 CCCGCCGCCCCAGGAGCCGCCGG + Intergenic
1184106202 22:42368827-42368849 CCGGGCGCCTCCGAATCCGGGGG - Intergenic
1184759546 22:46536975-46536997 CCGGGCGCCGCGGGAGCTGCTGG - Exonic
1185301734 22:50084411-50084433 CCCTGGGCCCCCAGAGCCGAGGG + Intronic
950282383 3:11719420-11719442 GCGGGCGCGCCCAGAGCCGCCGG - Intronic
950940389 3:16885101-16885123 CAGGGCGCCCTTGGCGCCGAGGG - Intronic
951558773 3:23945745-23945767 CCGGGCGGCCCGGGGGGCGATGG - Intronic
953413275 3:42701942-42701964 CTGGGCCCCCCAGCAGCCGACGG + Intronic
953750612 3:45605835-45605857 CAGGGCGCCACAGGAGCCCACGG - Intronic
958798673 3:98732677-98732699 CCGAGCGCCTCCGGAGTCGCGGG - Intronic
959085833 3:101849797-101849819 CCGGGCGAGCCGGGCGCCGAGGG - Exonic
960120790 3:113947661-113947683 CCGGGCGCCGCCGGTGCCTGCGG - Intergenic
961336057 3:126180388-126180410 CCTGGAGCCCCCGGAGCCCCCGG + Intronic
961665014 3:128489251-128489273 CCGGGCGCCCCCGGAGCCGAGGG - Intronic
968079152 3:195834674-195834696 CGAGGCGGCCCCAGAGCCGATGG + Intergenic
968583775 4:1406601-1406623 CCGGGCGCCGCGGGCGCCTAAGG - Intergenic
969682233 4:8649757-8649779 CCCGGGGCCCCCGGGGCCGGGGG + Intergenic
969787927 4:9473700-9473722 CCGGGCGCCCCCCGCGCTGCGGG + Intergenic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
971347390 4:25823757-25823779 CCAGGAGCCCAGGGAGCCGAAGG + Intronic
971457844 4:26860982-26861004 CCGGAGGCCGCCGGTGCCGATGG + Exonic
972960556 4:44447943-44447965 CCGTGCGCTCCCGGGCCCGAGGG + Exonic
973293326 4:48490700-48490722 CCGGCCGGCCCCGGGGCCGAGGG + Exonic
974792728 4:66712488-66712510 TCGGGCCCCACAGGAGCCGACGG + Intergenic
976704716 4:88008122-88008144 CCGCGCGCCCACGGAGCTCACGG - Exonic
984795757 4:183658964-183658986 CGGGGCGCCTCCTGAGCGGACGG + Exonic
984811107 4:183797375-183797397 CTGGGCGCCCGGGGAGGCGAGGG + Intergenic
985591329 5:766949-766971 CCGGCCCTCCCCGGAGCTGATGG - Exonic
992056590 5:72996863-72996885 ACGGGGGCCCCCGGGGCCGGCGG + Intronic
992105888 5:73448590-73448612 CCGGGCGCGAGCGGAGCCCAGGG - Intergenic
992320796 5:75611645-75611667 CCGGGCGCGCCCGGGGCCAAGGG + Exonic
994359981 5:98839636-98839658 CCCGGCGCCCCCGGAGCCAGCGG + Intergenic
997513148 5:134466612-134466634 CCGGGCACCCCCGGGGCAGCCGG - Intergenic
997955367 5:138274652-138274674 GCCGGCGCCCCGGGAGCCGCCGG + Exonic
999375123 5:151081171-151081193 CCGCGGGCCCCCGGAACCGCAGG - Intronic
1001431722 5:171667618-171667640 CCGGGGGCTCCCGGAGGGGAAGG - Intergenic
1002559723 5:180072864-180072886 CCAGGGGCCCCCGGACCAGAGGG + Intergenic
1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG + Exonic
1006458487 6:34144929-34144951 GCTGGCGCCCCCGGAGCCCTAGG - Intronic
1007927794 6:45663738-45663760 CTGGGCCGCCCCGGGGCCGAGGG + Intronic
1008673235 6:53794595-53794617 CCTGGCGCCCCCGGCGCGCAAGG + Intronic
1009437720 6:63636453-63636475 CGGGGCGCCCTCGCAGCAGACGG - Intronic
1013793693 6:113860441-113860463 CGGCGCGCCCCCGGAGCAGGAGG + Exonic
1018494634 6:164337248-164337270 ACGGGCGCCCACGGAGCAGTTGG - Intergenic
1018769037 6:166956322-166956344 CCGGGTGCGCCCGGAGCCCTGGG + Exonic
1019338030 7:494366-494388 CCGGGCGCCCCGGGAAGCGGCGG + Intergenic
1019472878 7:1230426-1230448 CGCGGCGCCGCCGCAGCCGAGGG + Intergenic
1020004296 7:4774164-4774186 GCGGGTGCCCCTGGAGCCGCAGG - Intronic
1023407856 7:39855068-39855090 CGGGGCGCCTCCTGAGCGGACGG + Intergenic
1023863802 7:44229438-44229460 TCGGGAGCCCCAGAAGCCGAGGG - Exonic
1026805877 7:73429465-73429487 CAGGGCGCCCCAGGGGCCGTGGG - Intergenic
1029494358 7:100889236-100889258 CCGGGAGCCCCGGAAGCCGGGGG + Exonic
1034128913 7:148698581-148698603 AGGGGCGCCCCCGGGGCCGCCGG + Intronic
1034192671 7:149223947-149223969 CGGGCGGCCCCCCGAGCCGAGGG + Exonic
1034197944 7:149262365-149262387 CCGGGCGTCCGCGGGGCCGAGGG - Intronic
1034227191 7:149493398-149493420 CTGTGTGACCCCGGAGCCGAGGG - Intronic
1034268289 7:149791548-149791570 CCTGGGGCCCCTGGAGCCCATGG + Intergenic
1034324791 7:150220550-150220572 CAGAGCGCCCTCGGAGCCGCTGG - Intergenic
1034344817 7:150379556-150379578 CCGCGCGCCCCCCGAGCCCCGGG + Intronic
1034768400 7:153748681-153748703 CAGAGCGCCCTCGGAGCCGCTGG + Intergenic
1034911668 7:155002984-155003006 CCGGGCGCCGCGGGGGCCGGGGG - Exonic
1035580668 8:737725-737747 CCGCGAGCCCCGGGAGCCGTCGG + Intronic
1039467994 8:37797353-37797375 CCGGGCGCGCCCCGAGCCTCGGG - Exonic
1041689900 8:60678705-60678727 CCGCGCGCACCCGAAGCCGCGGG - Intergenic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1043401863 8:79891957-79891979 TCGGGCGCCCCGGGAGGGGAAGG - Intergenic
1049685823 8:143938952-143938974 CTGGGCGCACCCTGAGCCCAGGG + Intronic
1049716388 8:144095049-144095071 CGTGGCGCCCCAGGGGCCGACGG + Exonic
1053188214 9:36036969-36036991 CCGGGCGGCTCCAGAGCCGCGGG - Exonic
1053372659 9:37576010-37576032 CCGGGGGACCGCGGAGCCGCGGG + Intronic
1058144704 9:101398830-101398852 CCGCCCGCCCCCGGACCAGAAGG - Intergenic
1061072931 9:128322885-128322907 CCGGGAGCCCGCAGAGCCGACGG - Exonic
1061222147 9:129258504-129258526 CCGAGCGCGCCCGGAGCAGGAGG - Intergenic
1062040550 9:134402411-134402433 CCAGGCGCCCACAGAGCCGTGGG - Intronic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062426233 9:136507463-136507485 CCTGGCGCCGGCTGAGCCGAAGG - Intronic
1062579206 9:137222093-137222115 GCGGCCGCCGCCGGAGCCGCCGG - Intergenic
1062601613 9:137320947-137320969 CCTGCCGCCCCTGGAGCCCAAGG + Intronic
1192624496 X:72713916-72713938 CCGGGTGCCACCGGAGCCTTCGG + Exonic
1200076803 X:153555223-153555245 CCTGGCGCCCCCTGAGGCCATGG - Intronic