ID: 961666230

View in Genome Browser
Species Human (GRCh38)
Location 3:128494567-128494589
Sequence CAGACACATGGGCAAACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 266}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961666230_961666235 6 Left 961666230 3:128494567-128494589 CCAGGTGTTTGCCCATGTGTCTG 0: 1
1: 0
2: 0
3: 18
4: 266
Right 961666235 3:128494596-128494618 TGTGTGGCATGTCTATGAATGGG 0: 1
1: 0
2: 0
3: 15
4: 175
961666230_961666234 5 Left 961666230 3:128494567-128494589 CCAGGTGTTTGCCCATGTGTCTG 0: 1
1: 0
2: 0
3: 18
4: 266
Right 961666234 3:128494595-128494617 GTGTGTGGCATGTCTATGAATGG 0: 1
1: 0
2: 1
3: 36
4: 174
961666230_961666236 16 Left 961666230 3:128494567-128494589 CCAGGTGTTTGCCCATGTGTCTG 0: 1
1: 0
2: 0
3: 18
4: 266
Right 961666236 3:128494606-128494628 GTCTATGAATGGGTGTGTTTTGG 0: 1
1: 0
2: 3
3: 34
4: 369
961666230_961666233 -10 Left 961666230 3:128494567-128494589 CCAGGTGTTTGCCCATGTGTCTG 0: 1
1: 0
2: 0
3: 18
4: 266
Right 961666233 3:128494580-128494602 CATGTGTCTGTAGCAGTGTGTGG 0: 1
1: 0
2: 0
3: 29
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961666230 Original CRISPR CAGACACATGGGCAAACACC TGG (reversed) Intergenic
900137407 1:1123900-1123922 CATACACTTGAGCACACACCTGG + Intergenic
900137440 1:1124206-1124228 CACACACCTGGACACACACCTGG + Intergenic
901151634 1:7107246-7107268 CATACACATGCACACACACCAGG - Intronic
902240455 1:15084965-15084987 CACAGACATGAGCAAACAACAGG + Intronic
903479074 1:23639922-23639944 CAGTCACCTGGGCCACCACCTGG - Intronic
903642772 1:24871161-24871183 CACCCACGTGGGCAAACATCCGG - Intergenic
903668647 1:25022711-25022733 CAGACAGATAGGCAGACAGCAGG - Intergenic
903806569 1:26009947-26009969 GAGACACATGAGGAAACACCAGG + Intergenic
903886544 1:26544130-26544152 CAGACACACGGGCAGGCAGCAGG - Intronic
905976106 1:42175126-42175148 CGGACACATGGACACACACACGG + Intergenic
906747261 1:48230903-48230925 CAGACACAGGGACAGAGACCAGG + Intronic
907744513 1:57199385-57199407 CAGAGAGAGGTGCAAACACCTGG + Intronic
910680161 1:89854822-89854844 CAGACACAACTGCAGACACCTGG - Intronic
911068265 1:93811475-93811497 CAGAGATAAGTGCAAACACCGGG + Intronic
911238458 1:95437752-95437774 AAGACACATTGCCAAACATCCGG - Intergenic
915086225 1:153390761-153390783 CAGAGACATGTGCACACACACGG + Intronic
915328415 1:155093246-155093268 CAGACACATACACAAACACAAGG + Intergenic
915735262 1:158080635-158080657 TACACGCCTGGGCAAACACCTGG + Intronic
915735463 1:158081890-158081912 CACACACCCGGGCACACACCTGG + Intronic
916515570 1:165513342-165513364 CAAGCACATGGGCACACACAGGG + Intergenic
917252596 1:173078270-173078292 CAGACACAGGGGCCAACATGAGG + Intergenic
919889258 1:201958556-201958578 CAGGCACATGCCCCAACACCTGG - Intronic
920276768 1:204812013-204812035 CAGTCACATGGGGAAGCAGCAGG - Intergenic
920354696 1:205362308-205362330 CAGACACAATGCTAAACACCAGG + Intergenic
921161403 1:212474801-212474823 CAGACACTATGGCAAACACCAGG + Intergenic
922807188 1:228396432-228396454 GAGACACATGGGCAAAGCCTGGG - Intronic
923514419 1:234682399-234682421 GAAACACATGGGGAAACACACGG + Intergenic
924203718 1:241688654-241688676 GAGACAGAGGGGCAAACACTGGG + Intronic
924414184 1:243841578-243841600 CAGGCACATCGGAAAACAGCTGG + Intronic
1063102576 10:2963300-2963322 CACACACCTGGCCACACACCTGG + Intergenic
1063428424 10:5967116-5967138 CACACACATGTGCACACACAAGG - Intronic
1063824583 10:9879797-9879819 CAGCCACATGGAAAAACTCCAGG - Intergenic
1063833692 10:9986954-9986976 CAGCCATAGGGGCAAACACTTGG - Intergenic
1064325196 10:14343819-14343841 CTGACATTTGAGCAAACACCTGG - Intronic
1067267487 10:44757942-44757964 CATACACATTGACAAGCACCAGG - Intergenic
1067647603 10:48123918-48123940 CAGACAAATGGACAAACAGATGG - Intergenic
1070972231 10:80577247-80577269 CAGACACATGAGCAAAGCCTTGG + Intronic
1071157864 10:82711899-82711921 CAGACACATAGACACACACATGG + Intronic
1071437271 10:85659163-85659185 CACACACATGTGCAAGCACATGG - Intronic
1072113617 10:92347340-92347362 CAGGCACATGGCACAACACCTGG - Intronic
1072753496 10:98000887-98000909 CATAGACATGGTCAAACACTTGG + Intronic
1076550006 10:131272261-131272283 CAGTCAGATATGCAAACACCTGG - Intronic
1076859106 10:133131860-133131882 CAGACACACGGGCACACACAAGG - Intergenic
1077484778 11:2833667-2833689 CAGAGAGGTGAGCAAACACCAGG + Intronic
1079693904 11:23454816-23454838 TAGACACTTGGAGAAACACCTGG + Intergenic
1080641452 11:34160804-34160826 CAGACACGTGGACAGACACAGGG - Intronic
1081743624 11:45457958-45457980 GGGCCACATGGGGAAACACCAGG + Intergenic
1086755649 11:90558484-90558506 CAGGCACAAGCGCCAACACCGGG - Intergenic
1087018954 11:93583036-93583058 CACACACATGCACAAATACCTGG - Intergenic
1087336178 11:96847726-96847748 TAGACACAGAGGCACACACCTGG - Intergenic
1088568326 11:111196617-111196639 CAGACACAGGGGCTATCTCCAGG - Intergenic
1088910171 11:114184893-114184915 CAGACACAGTGGCTCACACCTGG + Intronic
1089198424 11:116708911-116708933 CTGACACATGGTCAAAACCCAGG - Intergenic
1090254257 11:125272222-125272244 CAGACTTATGGAAAAACACCTGG - Intronic
1091186692 11:133653825-133653847 CAGACACATGAGCAGAACCCAGG - Intergenic
1091197497 11:133744535-133744557 CAGACACTTGAGGAAACCCCAGG - Intergenic
1091964000 12:4722718-4722740 CAGCCCCATGTGCACACACCTGG - Intronic
1092548127 12:9469221-9469243 CTGACATCTGGGCAAACAACTGG + Intergenic
1095474779 12:42575183-42575205 AAGACACAAGTGTAAACACCTGG + Intronic
1096693846 12:53336505-53336527 CACACTCATGGCCAAACACAGGG + Intronic
1096775304 12:53960059-53960081 CAGACCCAGGCTCAAACACCAGG - Intergenic
1103297440 12:119900099-119900121 CAGACACATGGCACCACACCTGG + Intergenic
1104931759 12:132342751-132342773 CAGATACATGTGCACACACAGGG - Intergenic
1104948929 12:132429954-132429976 TAGGCACATCGGCACACACCTGG + Intergenic
1105288152 13:19024707-19024729 CAGCCACTTGGGAAAACAACTGG + Intergenic
1105680742 13:22724889-22724911 CAAACACATGTGCAAATGCCTGG - Intergenic
1106563154 13:30863702-30863724 CAGCCACATTGCCAAACTCCAGG - Intergenic
1108215932 13:48184447-48184469 CTGACACATGGTCTAACAACAGG + Intergenic
1108563470 13:51670546-51670568 CAGGCATTTGGGAAAACACCAGG - Intronic
1108692100 13:52868680-52868702 CAGAGACATGGGGCAACAGCTGG + Intergenic
1109810136 13:67502421-67502443 CAGACACATTGGTAAATAACTGG + Intergenic
1113360849 13:109630148-109630170 CACAAACAGGGGAAAACACCGGG + Intergenic
1113796451 13:113061439-113061461 GAGACATATGGGCCAGCACCAGG + Intronic
1115718039 14:36127325-36127347 GACACACAGGGACAAACACCAGG - Intergenic
1115920777 14:38370926-38370948 CAGACACATGGCACCACACCTGG - Intergenic
1116272449 14:42788943-42788965 CAGGCACATGGGGAAAGAACAGG + Intergenic
1120767649 14:88344350-88344372 CAGAAAATTGGGCAAAAACCTGG + Intergenic
1121755513 14:96399213-96399235 CAGATACATGGATAAACACAGGG - Intronic
1123108398 14:105853766-105853788 CACACACACGGGCACACACATGG - Intergenic
1202839544 14_GL000009v2_random:108895-108917 CAGGCACATGGAAACACACCTGG - Intergenic
1124352850 15:28970886-28970908 CACACACATGGGCACACATACGG - Intronic
1125462999 15:39923896-39923918 CAGGCACATGTTAAAACACCTGG + Intergenic
1128606344 15:69039227-69039249 CAGACACAGGGGCATTCAGCTGG + Intronic
1128782896 15:70374622-70374644 CAGAGACAGGGGCCAACAGCAGG - Intergenic
1130072238 15:80657509-80657531 CAGACACATGCCTGAACACCTGG - Intergenic
1131465787 15:92654132-92654154 CAGACACAGAAGAAAACACCTGG + Intronic
1132118203 15:99153123-99153145 GTGACACATGGGCAAACGCAGGG + Intronic
1132696284 16:1203505-1203527 CATACATTTGGGCACACACCTGG - Intronic
1132886002 16:2182263-2182285 CAGACGCATGGGGCCACACCTGG + Intronic
1132912723 16:2323728-2323750 CAGACAGAGGGGCAAACAACAGG + Intronic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1135432433 16:22396914-22396936 CAGACATAGTGGCACACACCTGG + Intronic
1137556775 16:49475210-49475232 CACACACACGAGCACACACCAGG - Intergenic
1139205914 16:65028275-65028297 CAGAGGCAGGGGCAGACACCAGG - Intronic
1139385396 16:66565882-66565904 CTGTCACAAGTGCAAACACCTGG - Exonic
1139707011 16:68747904-68747926 CAGACACATGCCAACACACCCGG + Intronic
1140521618 16:75586731-75586753 CAAACACATGTGCAGACACCTGG + Intergenic
1140523263 16:75600410-75600432 CAGACACCTGAGCAAGCAACTGG + Intronic
1141923082 16:87149122-87149144 CAGAGACAAAGGAAAACACCAGG + Intronic
1143000007 17:3787532-3787554 CAGACACAGTGGCTCACACCTGG - Intronic
1143203179 17:5126125-5126147 AAGGCACTTGCGCAAACACCAGG - Intronic
1143304050 17:5932123-5932145 CAGAGCAATGGGAAAACACCAGG - Intronic
1144161782 17:12567179-12567201 CAGACACATAAACAAACACAGGG - Intergenic
1144596412 17:16573889-16573911 AAGAAATATGGGCAAACAACAGG + Intergenic
1144741052 17:17582465-17582487 GTGACACATGGACAAACAGCAGG + Intronic
1145759429 17:27417821-27417843 CACACACATGTGCAAACACATGG + Intergenic
1146678612 17:34791275-34791297 CAGGCACATGTGCACACACATGG + Intergenic
1146822842 17:35998531-35998553 CAGACACATGGCAAAACCCTGGG - Intronic
1146845664 17:36180282-36180304 AAGGCACTTGTGCAAACACCAGG + Intronic
1146873881 17:36392127-36392149 AAGGCACTTGTGCAAACACCAGG + Intronic
1146881237 17:36443217-36443239 AAGGCACTTGTGCAAACACCAGG + Intergenic
1147065509 17:37920744-37920766 AAGGCACTTGTGCAAACACCAGG - Intergenic
1147324116 17:39662300-39662322 CAGACAAAGGTGCAAACACGGGG - Exonic
1147538540 17:41336341-41336363 AAGGCACTTGTGCAAACACCAGG + Intergenic
1149848813 17:60023022-60023044 AAGGCACTTGTGCAAACACCAGG + Intergenic
1149861355 17:60123502-60123524 AAGGCACTTGTGCAAACACCAGG - Intergenic
1151212378 17:72554340-72554362 CATCCACATGCTCAAACACCTGG + Intergenic
1153004900 18:489407-489429 CAGACACATGCACACACACTGGG - Intronic
1153473770 18:5474453-5474475 CACACACATGTGCACACACAAGG - Intronic
1153503308 18:5770402-5770424 CAGAAACAGGGTCAGACACCTGG - Intergenic
1153839121 18:8990414-8990436 CAGGCAGATGGTCAGACACCTGG + Intergenic
1153951916 18:10064811-10064833 CAGATGCAGGGGCAAACACCTGG + Intergenic
1154471564 18:14707865-14707887 CAGCCACTTGGGAAAACAACCGG - Intergenic
1156921406 18:42526894-42526916 GGGCCACATGGGCAAGCACCAGG - Intergenic
1159216249 18:65394300-65394322 GAGACACATGGGCAGAGTCCAGG - Intergenic
1159457874 18:68685262-68685284 CAGAAATATGGGCATAAACCTGG + Intronic
1161353765 19:3807760-3807782 CATACGCATGGGCACACACATGG - Intronic
1161353771 19:3807837-3807859 CACACACACGGGCACACACATGG - Intronic
1161708584 19:5834336-5834358 CAGAGACATGGGGAACCCCCAGG + Intronic
1163113740 19:15177361-15177383 CAGACACACGGACAGACACGTGG + Intronic
1163229539 19:15991121-15991143 CAGACACATAGACAAAGACAAGG + Intergenic
1163602089 19:18255353-18255375 CTGGCACCTGGGCACACACCTGG - Exonic
1164722925 19:30445208-30445230 AAGACACTTTGGCAAACGCCGGG + Exonic
1165853975 19:38869228-38869250 CAGCCAGATGGGCAGTCACCTGG + Exonic
1166496850 19:43309437-43309459 CAGACTGATGGGCAAGCTCCTGG + Intergenic
1168270242 19:55245833-55245855 CAGAAACAAGGGCCCACACCAGG + Intronic
925904647 2:8533147-8533169 CAGCCACATGGGCAGAAATCAGG + Intergenic
926125085 2:10267068-10267090 CAGACACCAGGGCAACCTCCTGG - Intergenic
926755045 2:16227609-16227631 CAGACACCTATGCAAAAACCTGG + Intergenic
928149862 2:28817219-28817241 CAGAAACACGGGAAAATACCTGG + Intronic
930116671 2:47724076-47724098 CAGAGGCATGAGCAAAGACCTGG - Intronic
930504952 2:52271864-52271886 GAGAGACATGGGCAAACAGTGGG + Intergenic
931332234 2:61299607-61299629 CAGGCACATTGGCATGCACCTGG + Intronic
931777628 2:65554020-65554042 CAGACACATGGTACAACACGTGG + Intergenic
931848930 2:66233828-66233850 AATACACATAGGCACACACCTGG - Intergenic
935620818 2:105128089-105128111 GAGACACATGAGGAAACACCAGG + Intergenic
936073578 2:109387419-109387441 CAGACACATGGGCAGAAATAAGG - Intronic
937148893 2:119672359-119672381 CACCCACCTGGGGAAACACCAGG + Intergenic
937409598 2:121661825-121661847 CAGAAACATGGGCAAAGGCAGGG + Intergenic
937702915 2:124884371-124884393 AAAACACATGGGCACACACATGG - Intronic
940569030 2:155406384-155406406 CAGAAACAAGGGAAAACTCCAGG - Intergenic
943431040 2:187801957-187801979 CAAACACAAGGGCAAAGAACTGG - Intergenic
945197048 2:207246485-207246507 CAGATGCATGGGCAAATCCCCGG - Intergenic
945780402 2:214164378-214164400 GATACACATGAGCAGACACCTGG + Intronic
945986193 2:216355792-216355814 CAGCCAAATGGGCCAACCCCTGG + Intronic
946079806 2:217107817-217107839 CAGGAACACGGGCAAACACTGGG - Intergenic
948055093 2:235005141-235005163 GTGACACCTGGGCAAACACCTGG - Intronic
1168888562 20:1277505-1277527 CAGACACACAGGCACACACACGG - Intronic
1168888567 20:1277680-1277702 CAGACACACAGGCACACACATGG - Intronic
1168888573 20:1277853-1277875 CAGACACACAGGCACACACACGG - Intronic
1170597575 20:17817294-17817316 CAAACAAATGGGCAAGCAACAGG + Intergenic
1170777713 20:19392046-19392068 CCGACACCTAGGCAAACAGCAGG - Intronic
1172011109 20:31846404-31846426 GAGACACAGGTGCAAACACAAGG + Intergenic
1172695720 20:36821573-36821595 CAGACACATGCCACAACACCCGG - Intronic
1173773056 20:45680577-45680599 CAAAGACATGGGCATACAACGGG - Intergenic
1173794243 20:45847917-45847939 CAGACACATGCCCCGACACCCGG + Intronic
1175295803 20:57907968-57907990 AAGAAACATGGGCAAAGACAGGG - Intergenic
1175527002 20:59641816-59641838 CAGAAACATTGGAAACCACCAGG - Intronic
1176182717 20:63758438-63758460 GAGACACATGGGGAAGCACCAGG - Intronic
1176802923 21:13450056-13450078 CAGCCACTTGGGAAAACAACTGG + Intergenic
1178047756 21:28713983-28714005 CAGACTCATGGACAAATTCCAGG - Intergenic
1178251868 21:31010906-31010928 CTGAGAAATTGGCAAACACCAGG - Intergenic
1179006840 21:37522796-37522818 CAGAGAAATGGGCAAAGAGCAGG - Intergenic
1179458856 21:41519993-41520015 CAGACACTGGGACAAACACTGGG - Intronic
1181174997 22:21030250-21030272 GGTGCACATGGGCAAACACCTGG + Exonic
1181406153 22:22686402-22686424 CAGCCCCATGGCCAAACTCCTGG + Intergenic
1184804984 22:46788941-46788963 CAGAAACATGAGCCCACACCCGG - Intronic
950303813 3:11903466-11903488 CAGCCACTTGGGAAACCACCTGG - Intergenic
950532874 3:13563211-13563233 CAGACACACAGCCACACACCAGG - Intronic
952042924 3:29281675-29281697 CAGCTACATGGGCAAACGCCTGG + Exonic
954215696 3:49123191-49123213 CAAACACATGGCCAACCAGCGGG - Exonic
954521135 3:51227653-51227675 CAGACACTAGGTCAGACACCAGG - Intronic
955916231 3:63911768-63911790 CTGACACCTGGGCAGACACCTGG + Intronic
956474265 3:69602834-69602856 CAGTCACATCCGCAAGCACCTGG - Intergenic
956689621 3:71863841-71863863 GAGCCACATGGGGAAGCACCAGG + Intergenic
957153941 3:76522359-76522381 CAGACACATGGGCACACAGTTGG - Intronic
957294120 3:78314191-78314213 CAGACAAATGGGGAAACCCCAGG - Intergenic
958623050 3:96586619-96586641 CAGAAACCTGAGGAAACACCAGG + Intergenic
959557993 3:107745412-107745434 AAAACAGTTGGGCAAACACCAGG - Intronic
960436619 3:117634361-117634383 CATAGACAAGGCCAAACACCTGG - Intergenic
960668859 3:120137515-120137537 CACACTCCTGGGCAGACACCAGG - Intergenic
961524010 3:127484976-127484998 CAGCCACATGGCCACACCCCAGG - Intergenic
961666230 3:128494567-128494589 CAGACACATGGGCAAACACCTGG - Intergenic
963114152 3:141711797-141711819 CAGGCACATGCCCCAACACCCGG + Intergenic
964258629 3:154808707-154808729 CAGGCACATGCCAAAACACCTGG + Intergenic
965903383 3:173671748-173671770 CAAACACAAGGTAAAACACCTGG + Intronic
967581105 3:191155899-191155921 CATAGACATGGGAAGACACCTGG - Intergenic
968611979 4:1561446-1561468 CAGACACATGTGGACACACGTGG - Intergenic
968662989 4:1806480-1806502 CAGACACCTGGGCGGGCACCAGG - Intronic
978033068 4:103959608-103959630 CACACACATGGGCATAAACATGG + Intergenic
981430358 4:144650494-144650516 CAGACACATAGGCAAAAAAGAGG + Intronic
982695665 4:158596847-158596869 CAAACAAATGGGGAAAAACCAGG + Intronic
985299777 4:188475674-188475696 CAGAAACAAGGGAAAACAGCAGG + Intergenic
986731225 5:10636333-10636355 CAGACACAGTGGCTCACACCTGG + Intronic
987222214 5:15802404-15802426 CAGACACAAGGGTAGACATCTGG - Intronic
988411534 5:30892266-30892288 CAGACACATGTGCAAGCTACAGG + Intergenic
990630416 5:57662564-57662586 CAGTCTCCTGGGCAGACACCAGG + Intergenic
991302786 5:65145333-65145355 CAGACACAGAGGCTCACACCTGG + Intergenic
991395918 5:66205331-66205353 GATACACAAGGGCACACACCAGG - Intergenic
992100275 5:73401078-73401100 CATACACCGGGACAAACACCTGG + Intergenic
992921215 5:81523726-81523748 CAGCCACATGGTCAAACTCTAGG + Intronic
995751559 5:115457868-115457890 GAGACACACGGGCAGACTCCCGG + Intergenic
995919323 5:117292537-117292559 CAGACTGACGGTCAAACACCAGG - Intergenic
999433492 5:151544016-151544038 CAGACACATTGACAACCACAAGG + Exonic
1005797583 6:29382822-29382844 CAAAAACATGGGCAAAAACTAGG + Intronic
1005836024 6:29710276-29710298 CAGTCACAGGGGCAACCAACAGG - Intergenic
1006055255 6:31379196-31379218 CAGTCACAGGGGCAACCAACAGG + Intergenic
1006173999 6:32110834-32110856 CAGACACACGGACACACACGGGG - Intronic
1006260937 6:32869908-32869930 CACACACATGCACACACACCAGG + Intergenic
1010934568 6:81845874-81845896 CAGACTCATGGAGAAACAGCAGG + Intergenic
1011175861 6:84559665-84559687 CAGATACATGGGCAAAGATGAGG + Intergenic
1012759785 6:103284598-103284620 CAGACAGAAGGGCAATTACCCGG - Intergenic
1014070027 6:117170003-117170025 CACACACATGAGCAAGCACAAGG + Intergenic
1017803313 6:157919995-157920017 CAGACACAGGAGCAAACTCTAGG - Intronic
1019516614 7:1442951-1442973 CAGACACAGGGCCAGACACAAGG + Intronic
1020116405 7:5478809-5478831 CAGGCACATGTGCACACACAGGG + Intronic
1021913006 7:25405221-25405243 CTGACACCTGGGGAAACACTGGG - Intergenic
1022492365 7:30830835-30830857 GAGCCACATGGGCAAATGCCTGG + Intronic
1023514823 7:40991654-40991676 CAGACACATGGTCAAACGGGAGG - Intergenic
1023722107 7:43106806-43106828 CAGACACAAGGCAAATCACCTGG - Intergenic
1024581439 7:50804082-50804104 CAGACACATGCCCTGACACCTGG + Intergenic
1025157095 7:56616865-56616887 CTAACACATGGGCAGAAACCAGG + Intergenic
1028034323 7:85960806-85960828 CAGACACAGGGGCAACCTCTAGG - Intergenic
1028752501 7:94395992-94396014 CAGACTCATGGGAAAAACCCCGG - Intronic
1029563338 7:101318777-101318799 CAGACACATGCCAACACACCTGG + Intronic
1030505895 7:110421764-110421786 CAGACCCAGGGACAAACAGCAGG + Intergenic
1031013616 7:116549121-116549143 CACACACATGGGAAAACATGAGG + Intronic
1031281756 7:119811728-119811750 GAGAGACATGGGGAAACAGCTGG + Intergenic
1032394786 7:131581599-131581621 CGGACACAGGGGCCACCACCCGG - Intergenic
1032395080 7:131583603-131583625 CACACACTTGGGCACAGACCCGG - Intergenic
1033119234 7:138652326-138652348 CAGACACAGTGGCTCACACCTGG - Intronic
1034624828 7:152484631-152484653 CAGACACATGCCCCCACACCTGG + Intergenic
1036613899 8:10373687-10373709 CAGGCACAGGGGGCAACACCAGG + Intronic
1039211193 8:35216657-35216679 CAGACATAAGGGCAAACTCTAGG - Intergenic
1039491054 8:37947704-37947726 TAGATACATGGGCTAACAGCTGG - Intergenic
1039562959 8:38527808-38527830 CAGACACCTGGGTCCACACCTGG + Intronic
1040551750 8:48443245-48443267 CATACACATGGGCCAACCCTGGG + Intergenic
1042055008 8:64755153-64755175 CACACACATATGCACACACCTGG - Intronic
1043445037 8:80311053-80311075 CTGAGAGATGGGCAAAAACCAGG - Intergenic
1043820602 8:84858947-84858969 CAGTAACATGGGCTAACACGAGG - Intronic
1046870330 8:119198355-119198377 CAGATACATGGCCAAACTCATGG - Intronic
1048061184 8:130920691-130920713 CAGATATTTGGTCAAACACCAGG + Intronic
1048648386 8:136447836-136447858 CAGACATCTGGGGAAACACGTGG + Intergenic
1049423999 8:142529320-142529342 CAAACACATCTGCACACACCTGG - Intronic
1049443050 8:142617894-142617916 CACACACATGCGCAAACACATGG + Intergenic
1049537751 8:143189852-143189874 CAGACACCCTGACAAACACCCGG - Intergenic
1050368070 9:4890903-4890925 CAGGCACATGGCCCCACACCTGG - Intergenic
1050668448 9:7968199-7968221 GGGACACATGGGGAATCACCAGG - Intergenic
1050955610 9:11654197-11654219 CAGACACATTGTCAGGCACCAGG - Intergenic
1053345220 9:37373106-37373128 CACACACATAAGCAAACACTAGG + Intergenic
1055191978 9:73536223-73536245 GAGACACATGGACAAATATCTGG + Intergenic
1056761237 9:89416542-89416564 CAGGGACATGCACAAACACCAGG + Intronic
1058959893 9:109982955-109982977 CAAAGACATGGGCAGACAGCTGG - Intronic
1059813682 9:117886817-117886839 AAGACACATGGGTGAACACATGG + Intergenic
1060417898 9:123445520-123445542 CATACCCATGTGCACACACCTGG - Intronic
1061613443 9:131763617-131763639 CAGACAGATGGGCAGACAGAGGG + Intergenic
1061941491 9:133886564-133886586 CAGACACAGGCGCAAACACGTGG - Intronic
1062125873 9:134862192-134862214 CACACACATGCGCACACACACGG - Intergenic
1062136537 9:134931580-134931602 CACACACACAGGCACACACCTGG - Intergenic
1185735369 X:2491807-2491829 CACACACCTGTGCAAACATCAGG + Intronic
1188682680 X:33030935-33030957 CAGACAAATGGTCAAACACAGGG + Intronic
1190434107 X:50406584-50406606 CAGACACAGGGGAGAACACCAGG + Intronic
1190976973 X:55414931-55414953 CAGACACACAGGCACACACACGG + Intergenic
1192036663 X:67570139-67570161 CACACACAGGGACAAACACAGGG - Intronic
1194036478 X:88879937-88879959 CACACACATGTGCACACACACGG - Intergenic
1195478288 X:105313398-105313420 CAGAAACAGGGACAAACATCAGG + Intronic
1199047498 X:143193684-143193706 CAGACACATGCGCACACAAAAGG + Intergenic
1199406217 X:147463884-147463906 CAGACACAGGAGCAATCCCCAGG + Intergenic
1199825858 X:151498573-151498595 CAAATACATGCGAAAACACCAGG - Intergenic
1200865696 Y:8040941-8040963 CTGACACATGGGCAGAAAACAGG - Intergenic
1200870728 Y:8095244-8095266 CTAACACATGGGAAGACACCAGG + Intergenic
1200901546 Y:8437547-8437569 CTAACACATGGGCAGAAACCTGG + Intergenic
1202252512 Y:22888040-22888062 CTAACACATGGGCAGAAACCAGG + Intergenic
1202405501 Y:24521789-24521811 CTAACACATGGGCAGAAACCAGG + Intergenic
1202465279 Y:25148293-25148315 CTAACACATGGGCAGAAACCAGG - Intergenic