ID: 961666790

View in Genome Browser
Species Human (GRCh38)
Location 3:128497738-128497760
Sequence TGGAAAAATACAGCCTTTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961666790_961666799 17 Left 961666790 3:128497738-128497760 CCGACAAAGGCTGTATTTTTCCA No data
Right 961666799 3:128497778-128497800 CGCGCGCGCGATGGTCCCCATGG No data
961666790_961666794 8 Left 961666790 3:128497738-128497760 CCGACAAAGGCTGTATTTTTCCA No data
Right 961666794 3:128497769-128497791 CCCCGCCCGCGCGCGCGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961666790 Original CRISPR TGGAAAAATACAGCCTTTGT CGG (reversed) Intergenic
No off target data available for this crispr