ID: 961666792

View in Genome Browser
Species Human (GRCh38)
Location 3:128497758-128497780
Sequence GCGCGGGCGGGGCGCGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961666792_961666799 -3 Left 961666792 3:128497758-128497780 CCAGGCTCGCGCCCCGCCCGCGC No data
Right 961666799 3:128497778-128497800 CGCGCGCGCGATGGTCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961666792 Original CRISPR GCGCGGGCGGGGCGCGAGCC TGG (reversed) Intergenic
No off target data available for this crispr