ID: 961666794

View in Genome Browser
Species Human (GRCh38)
Location 3:128497769-128497791
Sequence CCCCGCCCGCGCGCGCGCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961666787_961666794 27 Left 961666787 3:128497719-128497741 CCGTTAGTGACACGCGCCGCCGA No data
Right 961666794 3:128497769-128497791 CCCCGCCCGCGCGCGCGCGATGG No data
961666790_961666794 8 Left 961666790 3:128497738-128497760 CCGACAAAGGCTGTATTTTTCCA No data
Right 961666794 3:128497769-128497791 CCCCGCCCGCGCGCGCGCGATGG No data
961666789_961666794 11 Left 961666789 3:128497735-128497757 CCGCCGACAAAGGCTGTATTTTT No data
Right 961666794 3:128497769-128497791 CCCCGCCCGCGCGCGCGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961666794 Original CRISPR CCCCGCCCGCGCGCGCGCGA TGG Intergenic
No off target data available for this crispr