ID: 961666799

View in Genome Browser
Species Human (GRCh38)
Location 3:128497778-128497800
Sequence CGCGCGCGCGATGGTCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961666789_961666799 20 Left 961666789 3:128497735-128497757 CCGCCGACAAAGGCTGTATTTTT No data
Right 961666799 3:128497778-128497800 CGCGCGCGCGATGGTCCCCATGG No data
961666790_961666799 17 Left 961666790 3:128497738-128497760 CCGACAAAGGCTGTATTTTTCCA No data
Right 961666799 3:128497778-128497800 CGCGCGCGCGATGGTCCCCATGG No data
961666792_961666799 -3 Left 961666792 3:128497758-128497780 CCAGGCTCGCGCCCCGCCCGCGC No data
Right 961666799 3:128497778-128497800 CGCGCGCGCGATGGTCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961666799 Original CRISPR CGCGCGCGCGATGGTCCCCA TGG Intergenic
No off target data available for this crispr