ID: 961668702

View in Genome Browser
Species Human (GRCh38)
Location 3:128510683-128510705
Sequence CCCAATGCCCACTTCAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961668702_961668706 10 Left 961668702 3:128510683-128510705 CCACATCTGAAGTGGGCATTGGG No data
Right 961668706 3:128510716-128510738 CTCTAGTGGCCAGTTCCTAATGG No data
961668702_961668705 -4 Left 961668702 3:128510683-128510705 CCACATCTGAAGTGGGCATTGGG No data
Right 961668705 3:128510702-128510724 TGGGGATCTCAGTTCTCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961668702 Original CRISPR CCCAATGCCCACTTCAGATG TGG (reversed) Intergenic
No off target data available for this crispr