ID: 961668705

View in Genome Browser
Species Human (GRCh38)
Location 3:128510702-128510724
Sequence TGGGGATCTCAGTTCTCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961668695_961668705 9 Left 961668695 3:128510670-128510692 CCCTTCACCATTCCCACATCTGA No data
Right 961668705 3:128510702-128510724 TGGGGATCTCAGTTCTCTAGTGG No data
961668694_961668705 12 Left 961668694 3:128510667-128510689 CCACCCTTCACCATTCCCACATC No data
Right 961668705 3:128510702-128510724 TGGGGATCTCAGTTCTCTAGTGG No data
961668693_961668705 13 Left 961668693 3:128510666-128510688 CCCACCCTTCACCATTCCCACAT No data
Right 961668705 3:128510702-128510724 TGGGGATCTCAGTTCTCTAGTGG No data
961668696_961668705 8 Left 961668696 3:128510671-128510693 CCTTCACCATTCCCACATCTGAA No data
Right 961668705 3:128510702-128510724 TGGGGATCTCAGTTCTCTAGTGG No data
961668691_961668705 18 Left 961668691 3:128510661-128510683 CCCTGCCCACCCTTCACCATTCC No data
Right 961668705 3:128510702-128510724 TGGGGATCTCAGTTCTCTAGTGG No data
961668692_961668705 17 Left 961668692 3:128510662-128510684 CCTGCCCACCCTTCACCATTCCC No data
Right 961668705 3:128510702-128510724 TGGGGATCTCAGTTCTCTAGTGG No data
961668700_961668705 -3 Left 961668700 3:128510682-128510704 CCCACATCTGAAGTGGGCATTGG No data
Right 961668705 3:128510702-128510724 TGGGGATCTCAGTTCTCTAGTGG No data
961668699_961668705 2 Left 961668699 3:128510677-128510699 CCATTCCCACATCTGAAGTGGGC No data
Right 961668705 3:128510702-128510724 TGGGGATCTCAGTTCTCTAGTGG No data
961668702_961668705 -4 Left 961668702 3:128510683-128510705 CCACATCTGAAGTGGGCATTGGG No data
Right 961668705 3:128510702-128510724 TGGGGATCTCAGTTCTCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961668705 Original CRISPR TGGGGATCTCAGTTCTCTAG TGG Intergenic
No off target data available for this crispr