ID: 961672816

View in Genome Browser
Species Human (GRCh38)
Location 3:128547384-128547406
Sequence CCTGTACTGCAGAGGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961672816_961672823 3 Left 961672816 3:128547384-128547406 CCTTCCAGCCTCTGCAGTACAGG No data
Right 961672823 3:128547410-128547432 GACCCCAAAAGGTGGTGACATGG No data
961672816_961672821 -8 Left 961672816 3:128547384-128547406 CCTTCCAGCCTCTGCAGTACAGG No data
Right 961672821 3:128547399-128547421 AGTACAGGAAGGACCCCAAAAGG No data
961672816_961672822 -5 Left 961672816 3:128547384-128547406 CCTTCCAGCCTCTGCAGTACAGG No data
Right 961672822 3:128547402-128547424 ACAGGAAGGACCCCAAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961672816 Original CRISPR CCTGTACTGCAGAGGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr