ID: 961672821

View in Genome Browser
Species Human (GRCh38)
Location 3:128547399-128547421
Sequence AGTACAGGAAGGACCCCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961672815_961672821 12 Left 961672815 3:128547364-128547386 CCAGAAAAGGTACTTTGTATCCT No data
Right 961672821 3:128547399-128547421 AGTACAGGAAGGACCCCAAAAGG No data
961672813_961672821 29 Left 961672813 3:128547347-128547369 CCTAGCTGTGAGGGAGTCCAGAA No data
Right 961672821 3:128547399-128547421 AGTACAGGAAGGACCCCAAAAGG No data
961672816_961672821 -8 Left 961672816 3:128547384-128547406 CCTTCCAGCCTCTGCAGTACAGG No data
Right 961672821 3:128547399-128547421 AGTACAGGAAGGACCCCAAAAGG No data
961672812_961672821 30 Left 961672812 3:128547346-128547368 CCCTAGCTGTGAGGGAGTCCAGA No data
Right 961672821 3:128547399-128547421 AGTACAGGAAGGACCCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961672821 Original CRISPR AGTACAGGAAGGACCCCAAA AGG Intergenic
No off target data available for this crispr