ID: 961672822

View in Genome Browser
Species Human (GRCh38)
Location 3:128547402-128547424
Sequence ACAGGAAGGACCCCAAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961672818_961672822 -9 Left 961672818 3:128547388-128547410 CCAGCCTCTGCAGTACAGGAAGG No data
Right 961672822 3:128547402-128547424 ACAGGAAGGACCCCAAAAGGTGG No data
961672815_961672822 15 Left 961672815 3:128547364-128547386 CCAGAAAAGGTACTTTGTATCCT No data
Right 961672822 3:128547402-128547424 ACAGGAAGGACCCCAAAAGGTGG No data
961672816_961672822 -5 Left 961672816 3:128547384-128547406 CCTTCCAGCCTCTGCAGTACAGG No data
Right 961672822 3:128547402-128547424 ACAGGAAGGACCCCAAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961672822 Original CRISPR ACAGGAAGGACCCCAAAAGG TGG Intergenic
No off target data available for this crispr