ID: 961674644

View in Genome Browser
Species Human (GRCh38)
Location 3:128557137-128557159
Sequence TGGGTTTCCACCCAGCTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961674644_961674655 12 Left 961674644 3:128557137-128557159 CCGTCCAGCTGGGTGGAAACCCA No data
Right 961674655 3:128557172-128557194 ACGAAAGTGCAGGCCTTGGTGGG No data
961674644_961674653 8 Left 961674644 3:128557137-128557159 CCGTCCAGCTGGGTGGAAACCCA No data
Right 961674653 3:128557168-128557190 GGTCACGAAAGTGCAGGCCTTGG No data
961674644_961674654 11 Left 961674644 3:128557137-128557159 CCGTCCAGCTGGGTGGAAACCCA No data
Right 961674654 3:128557171-128557193 CACGAAAGTGCAGGCCTTGGTGG No data
961674644_961674656 13 Left 961674644 3:128557137-128557159 CCGTCCAGCTGGGTGGAAACCCA No data
Right 961674656 3:128557173-128557195 CGAAAGTGCAGGCCTTGGTGGGG No data
961674644_961674650 2 Left 961674644 3:128557137-128557159 CCGTCCAGCTGGGTGGAAACCCA No data
Right 961674650 3:128557162-128557184 GCCACCGGTCACGAAAGTGCAGG No data
961674644_961674657 18 Left 961674644 3:128557137-128557159 CCGTCCAGCTGGGTGGAAACCCA No data
Right 961674657 3:128557178-128557200 GTGCAGGCCTTGGTGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961674644 Original CRISPR TGGGTTTCCACCCAGCTGGA CGG (reversed) Intergenic
No off target data available for this crispr