ID: 961675210

View in Genome Browser
Species Human (GRCh38)
Location 3:128560841-128560863
Sequence TCTCTGTCCTGGGGGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961675210_961675227 12 Left 961675210 3:128560841-128560863 CCCAGAGCCCCCCAGGACAGAGA No data
Right 961675227 3:128560876-128560898 TGGCAGCAGGGCTGGCGGCCTGG No data
961675210_961675221 0 Left 961675210 3:128560841-128560863 CCCAGAGCCCCCCAGGACAGAGA No data
Right 961675221 3:128560864-128560886 CCTGGTCCCCAGTGGCAGCAGGG No data
961675210_961675225 7 Left 961675210 3:128560841-128560863 CCCAGAGCCCCCCAGGACAGAGA No data
Right 961675225 3:128560871-128560893 CCCAGTGGCAGCAGGGCTGGCGG No data
961675210_961675219 -1 Left 961675210 3:128560841-128560863 CCCAGAGCCCCCCAGGACAGAGA No data
Right 961675219 3:128560863-128560885 ACCTGGTCCCCAGTGGCAGCAGG No data
961675210_961675218 -8 Left 961675210 3:128560841-128560863 CCCAGAGCCCCCCAGGACAGAGA No data
Right 961675218 3:128560856-128560878 GACAGAGACCTGGTCCCCAGTGG No data
961675210_961675228 19 Left 961675210 3:128560841-128560863 CCCAGAGCCCCCCAGGACAGAGA No data
Right 961675228 3:128560883-128560905 AGGGCTGGCGGCCTGGCTCTCGG No data
961675210_961675222 4 Left 961675210 3:128560841-128560863 CCCAGAGCCCCCCAGGACAGAGA No data
Right 961675222 3:128560868-128560890 GTCCCCAGTGGCAGCAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961675210 Original CRISPR TCTCTGTCCTGGGGGGCTCT GGG (reversed) Intergenic
No off target data available for this crispr