ID: 961675981

View in Genome Browser
Species Human (GRCh38)
Location 3:128567038-128567060
Sequence TTCAATAAAAAAGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961675975_961675981 22 Left 961675975 3:128566993-128567015 CCTTGGCAACATGGCAAGACCCC No data
Right 961675981 3:128567038-128567060 TTCAATAAAAAAGAGGAGGAAGG No data
961675976_961675981 3 Left 961675976 3:128567012-128567034 CCCCATCTGTGTTAAATATATAT No data
Right 961675981 3:128567038-128567060 TTCAATAAAAAAGAGGAGGAAGG No data
961675978_961675981 1 Left 961675978 3:128567014-128567036 CCATCTGTGTTAAATATATATAT No data
Right 961675981 3:128567038-128567060 TTCAATAAAAAAGAGGAGGAAGG No data
961675977_961675981 2 Left 961675977 3:128567013-128567035 CCCATCTGTGTTAAATATATATA No data
Right 961675981 3:128567038-128567060 TTCAATAAAAAAGAGGAGGAAGG No data
961675974_961675981 26 Left 961675974 3:128566989-128567011 CCAGCCTTGGCAACATGGCAAGA 0: 30
1: 1556
2: 16617
3: 73336
4: 159863
Right 961675981 3:128567038-128567060 TTCAATAAAAAAGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961675981 Original CRISPR TTCAATAAAAAAGAGGAGGA AGG Intergenic
No off target data available for this crispr