ID: 961679477

View in Genome Browser
Species Human (GRCh38)
Location 3:128589518-128589540
Sequence CAGAATATGGGGGAGTTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961679477_961679486 19 Left 961679477 3:128589518-128589540 CCTAAAAACTCCCCCATATTCTG No data
Right 961679486 3:128589560-128589582 CACCATCCCCTTCCAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961679477 Original CRISPR CAGAATATGGGGGAGTTTTT AGG (reversed) Intergenic
No off target data available for this crispr