ID: 961684501

View in Genome Browser
Species Human (GRCh38)
Location 3:128620361-128620383
Sequence AGGGTGCCTGCACTTTGCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 462}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961684501_961684517 11 Left 961684501 3:128620361-128620383 CCACAGCAAAGTGCAGGCACCCT 0: 1
1: 0
2: 4
3: 38
4: 462
Right 961684517 3:128620395-128620417 AGGATGCGGGCAGGGGCTACAGG 0: 1
1: 0
2: 1
3: 16
4: 216
961684501_961684508 -3 Left 961684501 3:128620361-128620383 CCACAGCAAAGTGCAGGCACCCT 0: 1
1: 0
2: 4
3: 38
4: 462
Right 961684508 3:128620381-128620403 CCTGGGCCCCCTGGAGGATGCGG 0: 1
1: 0
2: 3
3: 73
4: 687
961684501_961684519 20 Left 961684501 3:128620361-128620383 CCACAGCAAAGTGCAGGCACCCT 0: 1
1: 0
2: 4
3: 38
4: 462
Right 961684519 3:128620404-128620426 GCAGGGGCTACAGGGCATCCAGG 0: 1
1: 0
2: 2
3: 30
4: 302
961684501_961684520 26 Left 961684501 3:128620361-128620383 CCACAGCAAAGTGCAGGCACCCT 0: 1
1: 0
2: 4
3: 38
4: 462
Right 961684520 3:128620410-128620432 GCTACAGGGCATCCAGGATGTGG 0: 1
1: 0
2: 0
3: 17
4: 185
961684501_961684518 12 Left 961684501 3:128620361-128620383 CCACAGCAAAGTGCAGGCACCCT 0: 1
1: 0
2: 4
3: 38
4: 462
Right 961684518 3:128620396-128620418 GGATGCGGGCAGGGGCTACAGGG 0: 1
1: 0
2: 2
3: 21
4: 234
961684501_961684512 3 Left 961684501 3:128620361-128620383 CCACAGCAAAGTGCAGGCACCCT 0: 1
1: 0
2: 4
3: 38
4: 462
Right 961684512 3:128620387-128620409 CCCCCTGGAGGATGCGGGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 229
961684501_961684509 -2 Left 961684501 3:128620361-128620383 CCACAGCAAAGTGCAGGCACCCT 0: 1
1: 0
2: 4
3: 38
4: 462
Right 961684509 3:128620382-128620404 CTGGGCCCCCTGGAGGATGCGGG 0: 1
1: 1
2: 1
3: 38
4: 451
961684501_961684505 -9 Left 961684501 3:128620361-128620383 CCACAGCAAAGTGCAGGCACCCT 0: 1
1: 0
2: 4
3: 38
4: 462
Right 961684505 3:128620375-128620397 AGGCACCCTGGGCCCCCTGGAGG 0: 1
1: 0
2: 4
3: 34
4: 325
961684501_961684510 2 Left 961684501 3:128620361-128620383 CCACAGCAAAGTGCAGGCACCCT 0: 1
1: 0
2: 4
3: 38
4: 462
Right 961684510 3:128620386-128620408 GCCCCCTGGAGGATGCGGGCAGG 0: 1
1: 0
2: 1
3: 34
4: 281
961684501_961684514 4 Left 961684501 3:128620361-128620383 CCACAGCAAAGTGCAGGCACCCT 0: 1
1: 0
2: 4
3: 38
4: 462
Right 961684514 3:128620388-128620410 CCCCTGGAGGATGCGGGCAGGGG 0: 1
1: 0
2: 1
3: 28
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961684501 Original CRISPR AGGGTGCCTGCACTTTGCTG TGG (reversed) Exonic
900985739 1:6072012-6072034 AGGGTGGCAGCCCTCTGCTGAGG - Intronic
901767687 1:11514384-11514406 AGAGAACCTGGACTTTGCTGGGG - Exonic
901860096 1:12068776-12068798 AGGATGCTTGCTCCTTGCTGAGG + Intronic
902712067 1:18247289-18247311 TGGGTGCCTGGACTGTGCTGGGG + Intronic
902865187 1:19273360-19273382 CGGGTCCCTGGACTTTGCTCTGG - Intergenic
903540109 1:24092091-24092113 ATGGGGCCTCCTCTTTGCTGTGG + Intronic
903657673 1:24959146-24959168 AGGGAGCCTCCGCTTTGATGCGG + Intronic
905344864 1:37304463-37304485 TGGGTGCCTGCACATTCCTGGGG + Intergenic
905505402 1:38475699-38475721 AGTGTCCCTGCCCTTGGCTGTGG - Intergenic
906733548 1:48103362-48103384 TGTGTGCAGGCACTTTGCTGGGG + Intergenic
906954403 1:50359953-50359975 AGGGCTGCTGCAATTTGCTGGGG - Intergenic
907724104 1:57002724-57002746 AGAATGCCAGCACCTTGCTGTGG + Intronic
908930436 1:69311759-69311781 AGGGTTGCTACAGTTTGCTGGGG + Intergenic
910073543 1:83248270-83248292 AGGGAGCCTTCACTTTGCGCTGG - Intergenic
910513782 1:88036316-88036338 GAGGTGGCTGCACTGTGCTGGGG - Intergenic
912006503 1:104908394-104908416 ATGTTGCCTGTTCTTTGCTGTGG - Intergenic
914400702 1:147317187-147317209 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
914430243 1:147613983-147614005 TGAGTGCCAGCACTATGCTGGGG + Intronic
914915134 1:151814934-151814956 AGGGTGCCTCCGGTGTGCTGCGG + Exonic
915639701 1:157215369-157215391 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
915944484 1:160140004-160140026 GTGGGGCTTGCACTTTGCTGGGG - Intronic
916073428 1:161185777-161185799 AGGGTTCCTGGAGTGTGCTGTGG - Exonic
916486510 1:165264593-165264615 GGGATGTCTGCATTTTGCTGCGG + Intronic
916718183 1:167462392-167462414 AGAGTTCCTGCCCATTGCTGCGG - Intronic
917059240 1:171018275-171018297 AGGGTTGCTGCAGTTTTCTGGGG - Intronic
917060466 1:171032536-171032558 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
917079161 1:171238226-171238248 AGGGTTGCTGCAGTTTGCTGGGG - Intergenic
917269732 1:173259232-173259254 AGGGCTGCTGCAATTTGCTGGGG - Intergenic
917295591 1:173515924-173515946 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
917305309 1:173618021-173618043 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
917582273 1:176391323-176391345 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
918046532 1:180944934-180944956 AGGCTGGCTGCTCTTTCCTGGGG + Intronic
919220758 1:194625301-194625323 AGGGTTGCTGCAGTTTGCTGGGG - Intergenic
919586534 1:199447407-199447429 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
921736317 1:218633049-218633071 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
921880926 1:220253390-220253412 AGGGTTGCTGCAGTTTACTGGGG - Intronic
922035340 1:221842170-221842192 ATGGTGCCAGCACTGTGCTCTGG - Intergenic
922693673 1:227714277-227714299 AGGGCTACTGCAGTTTGCTGGGG - Intergenic
923099025 1:230797705-230797727 AGCGTGCCAGCACTGAGCTGGGG - Intronic
923195417 1:231662001-231662023 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
923822212 1:237457662-237457684 AGCCTGCCTGGCCTTTGCTGTGG + Intronic
924412435 1:243819881-243819903 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1062847199 10:717312-717334 AGGGTTTCTGCACTGTGTTGAGG + Intergenic
1064120110 10:12611230-12611252 GGGTTGCCTGCACTTTGATGGGG - Intronic
1064211011 10:13360442-13360464 ACGGTGCCTGGACTTGCCTGGGG + Intergenic
1064370373 10:14747555-14747577 AGGGTGGCTGCAGTTTGCTGGGG + Intronic
1066624276 10:37390497-37390519 AGGCTGCCTCCATTGTGCTGTGG - Intergenic
1067742419 10:48905680-48905702 GGGGTGTCCGCATTTTGCTGAGG - Intronic
1067757299 10:49014879-49014901 AGGCTGCCTGCACATTGAGGAGG - Exonic
1067765538 10:49083069-49083091 GGGGTTCCTGGACTCTGCTGAGG - Intronic
1068126779 10:52850880-52850902 AGGGCCACTGCAGTTTGCTGGGG + Intergenic
1068811062 10:61256759-61256781 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1069837936 10:71320797-71320819 AGGGTGCCTGCAGTGTGCCTGGG + Intronic
1069905740 10:71731079-71731101 AGGCAGCCTGAACCTTGCTGAGG + Intronic
1071134468 10:82437811-82437833 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1071402324 10:85285967-85285989 AGTGTCTCTGCACTTAGCTGGGG - Intergenic
1073945518 10:108745506-108745528 AAGGTGTTTGCACTCTGCTGTGG - Intergenic
1074755105 10:116618689-116618711 AGGTTGCCAGCAATTTCCTGAGG - Intergenic
1075343525 10:121665628-121665650 AGCATGCCTGCACTGTGCTCAGG - Intergenic
1076185219 10:128441149-128441171 AGGGTGCCTGCTCCTTCCTCTGG - Intergenic
1076185233 10:128441250-128441272 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1076728963 10:132428957-132428979 AGGGTGCCTGCTCTGAGCTAAGG - Intergenic
1076933095 10:133546813-133546835 AGGGTTGCTGCAGTTTGCTGGGG - Intronic
1077392336 11:2305763-2305785 TGGATGCCTGCACTGGGCTGGGG + Intronic
1077802161 11:5550649-5550671 AGGGTGCCTGCACTCAGCCGGGG + Intronic
1078501762 11:11885975-11885997 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1079481926 11:20890234-20890256 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1079587945 11:22149599-22149621 AGGGCTTCTGCAGTTTGCTGGGG + Intergenic
1079622159 11:22567655-22567677 AAGGTGGCTGCTCTGTGCTGGGG + Intergenic
1079869521 11:25780588-25780610 GGGGTGGCTACACTGTGCTGGGG - Intergenic
1080130797 11:28792562-28792584 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1081454842 11:43211842-43211864 AGGGCTGCTGCAGTTTGCTGAGG + Intergenic
1082768587 11:57187898-57187920 AGGGTGTCTGCACATGGCAGAGG + Exonic
1083333066 11:61908030-61908052 TGGGTGCCTGCAGTAGGCTGGGG - Intronic
1084906793 11:72354707-72354729 AGGGTCTCTGTACTTTTCTGTGG + Intronic
1087328550 11:96752853-96752875 AGGGCTGCTGCAGTTTGCTGAGG + Intergenic
1087718596 11:101636725-101636747 TGGTTGCCTGCACTTTCCTCTGG - Intronic
1088383289 11:109220958-109220980 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1089627375 11:119760101-119760123 AAGTTGCCTGCAGTTTGGTGGGG - Intergenic
1089682790 11:120128818-120128840 AGGGTGCTTGCCCTTTTCAGTGG + Intronic
1089805441 11:121083953-121083975 AGGGTGCCAGCATCTGGCTGTGG + Intronic
1092091719 12:5809242-5809264 AGGGTGGCTTCACATTGCTGTGG - Intronic
1092443072 12:8526956-8526978 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1092639884 12:10494118-10494140 AGGGTTGCTGCATTTTGCTGGGG - Intergenic
1092994513 12:13935991-13936013 ACAGTGGCTGCACTGTGCTGAGG + Intronic
1093383253 12:18521009-18521031 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1095303381 12:40613540-40613562 AGGGCTGTTGCACTTTGCTGGGG + Intergenic
1095536386 12:43253278-43253300 AGGGTGTCTGCTGTTTGCGGTGG - Intergenic
1096286284 12:50303399-50303421 ATGGAGCCTGCAGTTAGCTGAGG + Intergenic
1096663528 12:53145799-53145821 ATGATGCCTGCACATTGATGAGG + Intergenic
1097529433 12:60780424-60780446 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1099684215 12:85865465-85865487 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1100115198 12:91295106-91295128 AGGGCCACTGCAGTTTGCTGGGG - Intergenic
1100700557 12:97143348-97143370 AGATTTCCTGCACTTAGCTGGGG + Intergenic
1101186795 12:102289273-102289295 AGGGCTGCTGCAATTTGCTGGGG + Intergenic
1102482298 12:113232278-113232300 AGGGATCCTCCACATTGCTGAGG - Intronic
1103481136 12:121250268-121250290 AGGGAGCCTGCAGTGTGCTTGGG - Intronic
1103888314 12:124219713-124219735 AGGGTTGCTGCATTTAGCTGGGG - Intronic
1104256294 12:127142602-127142624 AGGGTGGCTGCAATTTGCTGGGG + Intergenic
1105585398 13:21738566-21738588 GGGGTCCCTGTGCTTTGCTGCGG - Intergenic
1105602020 13:21895951-21895973 AGTCTGTCTGCACTTTGATGAGG + Intergenic
1106000936 13:25722409-25722431 GTGCTGCCTGCATTTTGCTGGGG + Intronic
1106004879 13:25759459-25759481 AGTGTGCCTGACCTCTGCTGTGG - Intronic
1107119339 13:36779572-36779594 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
1107175544 13:37394675-37394697 AGCGTGGCTGCATTTTGCTGGGG - Intergenic
1108574027 13:51776611-51776633 AGGCTGCCTTCTCTCTGCTGTGG - Intronic
1109201680 13:59438114-59438136 AGAATGCTTGCCCTTTGCTGTGG - Intergenic
1109249421 13:60001128-60001150 AGTGAGCCTGCTCTTTGCTCTGG - Intronic
1109380360 13:61551381-61551403 AGTCTGCCTGCTCTTTGCTCTGG - Intergenic
1109471740 13:62816140-62816162 AGGGTCCATTCAGTTTGCTGGGG - Intergenic
1110790395 13:79581448-79581470 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1111092285 13:83462667-83462689 AGGGCTCCTGCAGTTTGCTAGGG - Intergenic
1111235159 13:85400158-85400180 AGGGCTCCTGCAGTTTTCTGAGG + Intergenic
1112076247 13:95916286-95916308 AGGGCTGCTGCAGTTTGCTGAGG - Intronic
1112578981 13:100662284-100662306 GCGGTGCCTGCACTCTGCTGGGG - Intronic
1114527094 14:23373238-23373260 AGGTGTCCTGCCCTTTGCTGGGG - Exonic
1114645636 14:24254644-24254666 ACGGTGAATGCAGTTTGCTGGGG - Exonic
1116250484 14:42475514-42475536 AGGGTGCATGCTCTTTGCTCCGG - Intergenic
1116317518 14:43417213-43417235 AGGGTTGTTGCAGTTTGCTGGGG + Intergenic
1117203152 14:53413039-53413061 AGAGAGCCTGCCCTCTGCTGGGG - Intergenic
1117857468 14:60050831-60050853 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1118523611 14:66616476-66616498 AGGGCCACTGCAATTTGCTGGGG + Intronic
1118703040 14:68453158-68453180 AGAGTGCCTGCACTTTAATGTGG + Intronic
1119614154 14:76087463-76087485 ACAGTGCCTGCAGTTTGCTAGGG + Intergenic
1119665072 14:76479642-76479664 GGGCTGCCTACACTCTGCTGGGG + Intronic
1120283177 14:82464369-82464391 AGGGTTGCTGCAGTTTGCTGGGG - Intergenic
1120443534 14:84566075-84566097 AAGGTACCTGCACCTTACTGGGG + Intergenic
1120932522 14:89863654-89863676 AGGGTGCATCCCCATTGCTGGGG - Intronic
1121142508 14:91555532-91555554 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1121502160 14:94446588-94446610 AGGGTGCTTCCACTTGGCTTAGG + Exonic
1121706899 14:96002834-96002856 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
1123098425 14:105777201-105777223 GGGGAGACTGCACTTGGCTGGGG + Intergenic
1126284491 15:46996066-46996088 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1126552898 15:49952971-49952993 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1126956337 15:53936759-53936781 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1127099945 15:55553910-55553932 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1128331594 15:66759835-66759857 AGGGTCCCTGCCCTCTGTTGGGG + Intronic
1129971495 15:79781235-79781257 AGGGCTCCTCCAGTTTGCTGGGG - Intergenic
1130030299 15:80308009-80308031 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1130315583 15:82792826-82792848 AGTGTGCTAGCATTTTGCTGAGG + Intronic
1130322375 15:82851986-82852008 AGCCTGTCTGCACCTTGCTGTGG + Intronic
1130969205 15:88718879-88718901 AGGTTCCCTGCTCTGTGCTGTGG + Intergenic
1131942660 15:97584719-97584741 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1132667551 16:1089142-1089164 AGGCTGCCTGTTCTGTGCTGGGG - Intergenic
1133910763 16:10064242-10064264 AGGGCCCCTGCATGTTGCTGTGG - Intronic
1134182782 16:12061229-12061251 AGGGAGCCTGCAGTCTGTTGGGG - Intronic
1136621197 16:31429536-31429558 AAGGTCCCTGCCCGTTGCTGAGG - Intergenic
1136776437 16:32874252-32874274 AGGGTGGGAGCACTGTGCTGCGG - Intergenic
1136894178 16:33987260-33987282 AGGGTGGGAGCACTGTGCTGCGG + Intergenic
1137052932 16:35728554-35728576 ACAATGCCTGCAGTTTGCTGAGG + Intergenic
1138136906 16:54531100-54531122 AGGGTGACAGCACTTTGGTGTGG + Intergenic
1139555812 16:67709436-67709458 AAGTATCCTGCACTTTGCTGAGG - Intronic
1140325791 16:74001557-74001579 AGTTTGCCAGCATTTTGCTGAGG + Intergenic
1140669988 16:77268987-77269009 AGAGCTCCTGCAGTTTGCTGGGG + Intronic
1141829331 16:86500922-86500944 AGTGTGCAAGCACTGTGCTGAGG - Intergenic
1141900643 16:86988251-86988273 TGTGTCCCTGCTCTTTGCTGGGG - Intergenic
1142011130 16:87714706-87714728 AGCGTGCCTGCAGTGTGCTCAGG + Intronic
1203078852 16_KI270728v1_random:1136361-1136383 AGGGTGGGAGCACTGTGCTGCGG - Intergenic
1143399547 17:6634815-6634837 AGGTTGACTGCAATTTGCTTTGG + Intronic
1144177087 17:12717899-12717921 AGGGTGCCACCTCTGTGCTGGGG + Intronic
1144616797 17:16783561-16783583 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1144895897 17:18532112-18532134 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1145136319 17:20412120-20412142 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1145959857 17:28881038-28881060 AGGGTTCCTGCCCCCTGCTGAGG + Intronic
1146797056 17:35789368-35789390 AGAGTTCCTTCACTTGGCTGCGG - Intronic
1147448159 17:40487598-40487620 GGTGGGCATGCACTTTGCTGTGG - Intronic
1149083592 17:52687138-52687160 TGGGTGCCTGCATTCAGCTGAGG - Intergenic
1150190378 17:63232513-63232535 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1150196409 17:63304342-63304364 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1150557991 17:66270844-66270866 AGCATGCCTGCACCTAGCTGTGG - Intergenic
1151713731 17:75820836-75820858 AGAGTGCCAGCATTTTGCTCGGG + Intronic
1151721370 17:75858199-75858221 ATGCTGCCTGCTCTTTGCTGGGG - Intergenic
1152045031 17:77930010-77930032 AAGGTGCCAGCCCTTTGCTCAGG - Intergenic
1153125436 18:1784925-1784947 AGGGTTTCTGCAGTTTGCTGGGG - Intergenic
1153261482 18:3228314-3228336 AGCGTGTCTGCCTTTTGCTGTGG + Intergenic
1154454826 18:14511042-14511064 AGGGTGGCTGTTCTGTGCTGAGG + Intronic
1155429932 18:25744322-25744344 AGGGTTGCTGCGGTTTGCTGGGG - Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1155763002 18:29589409-29589431 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1155945512 18:31845545-31845567 AGGATGCCTGCAATTTACTTGGG + Intronic
1156694918 18:39754236-39754258 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1156890104 18:42180933-42180955 AGGGTGCCAGGACTTTTCTTGGG + Intergenic
1158105549 18:53882073-53882095 AGGGCTACTGCAGTTTGCTGGGG + Intergenic
1161495319 19:4583293-4583315 AGGGAGCCTGCAGATTGCCGTGG - Intergenic
1163069823 19:14830000-14830022 AGGGTGGCGGCACATGGCTGTGG - Intronic
1163636786 19:18440756-18440778 AGGGAGCCCACACTTTGCTGGGG - Intergenic
1163804565 19:19387631-19387653 TGAGTGCCTTCACTTTCCTGAGG + Intronic
1163872265 19:19831569-19831591 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1163886037 19:19965846-19965868 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1163886048 19:19965947-19965969 AGGGTGCCTGCTCCTTTCTCTGG + Intergenic
1163888431 19:19989631-19989653 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1163897364 19:20071230-20071252 AGGGTTGCTGCACCTTGCTAGGG - Intergenic
1163935459 19:20438642-20438664 AGGGTTGCTGCAGTTTGCTAGGG + Intergenic
1163949565 19:20571424-20571446 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1163958272 19:20664106-20664128 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1165728826 19:38131159-38131181 AGGGAGCAGGCACTTTGTTGTGG - Intronic
1165822504 19:38685492-38685514 AGCCTGCCTGCCCTTTGCTGAGG - Intronic
1166243538 19:41510063-41510085 AGGGGGCGTGCACTCTTCTGTGG - Intergenic
1167028890 19:46943482-46943504 AGTGGGCTTGCACTTTGCTTAGG + Intronic
1167489075 19:49781541-49781563 AGGGTGTGTGCTCTGTGCTGTGG + Intronic
1168314949 19:55480963-55480985 AGGGTGGCCACAGTTTGCTGGGG + Intronic
925447398 2:3940147-3940169 AGGGCTGCTGCAGTTTGCTGAGG + Intergenic
925886439 2:8397282-8397304 AATGTACCAGCACTTTGCTGAGG + Intergenic
926304750 2:11629787-11629809 TGGGTGTCTGCACTTTGCACTGG + Intronic
926453944 2:13040840-13040862 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
927105228 2:19818407-19818429 AGGAAGTCTGGACTTTGCTGGGG - Intergenic
927254103 2:21024945-21024967 TGGGTGCCCGCACTCTGCAGGGG - Exonic
928082856 2:28325974-28325996 GGGAGTCCTGCACTTTGCTGTGG + Intronic
928503133 2:31919179-31919201 TGGGTGACAGCATTTTGCTGGGG + Intronic
928803804 2:35126064-35126086 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
929881613 2:45841871-45841893 TGCTTGCCTGCTCTTTGCTGGGG + Intronic
930424232 2:51193512-51193534 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
930545870 2:52766378-52766400 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
930552371 2:52852131-52852153 AGGGCTGCTGCACTTTGCTGGGG + Intergenic
931640533 2:64377226-64377248 GGGGTGTCAGCTCTTTGCTGAGG - Intergenic
933129594 2:78655696-78655718 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
933436445 2:82256545-82256567 AGGGTGGCTGCAGTTTGCTGGGG + Intergenic
933482669 2:82876486-82876508 AGGGTTGCTGCAGTTTGCTGTGG - Intergenic
934622770 2:95825697-95825719 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
934923577 2:98366155-98366177 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
934990831 2:98920483-98920505 GGGGTGCCAGCACTTTCCTGCGG + Intronic
935360727 2:102244468-102244490 AGGGTGCCAGCAGTGTTCTGAGG - Intergenic
935376096 2:102399434-102399456 AGGCTGCAGGCACTTTTCTGGGG + Intergenic
936848988 2:116873475-116873497 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
937235725 2:120430878-120430900 AGGGTGCCTGGACTGAGTTGTGG + Intergenic
937893856 2:126962871-126962893 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
937931608 2:127209235-127209257 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
938136723 2:128765389-128765411 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
938452159 2:131431072-131431094 AGGGAGCCTGCATTCTGCTGAGG + Intergenic
939109811 2:137992918-137992940 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
939180048 2:138794128-138794150 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
939391228 2:141571290-141571312 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
939809070 2:146808747-146808769 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
939860550 2:147415283-147415305 TGGGTGCCTGCCCTTTCCTCTGG + Intergenic
940124693 2:150310415-150310437 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
942874514 2:180778372-180778394 AGGGGTCCTGTGCTTTGCTGTGG - Intergenic
944872840 2:203931654-203931676 AGGGAGCCTGAACTCTGCAGAGG + Intergenic
944956053 2:204810703-204810725 AGTTTGCCAGCATTTTGCTGAGG + Intronic
945366598 2:208962368-208962390 AGTATGCCAGCATTTTGCTGAGG - Intergenic
947646273 2:231743485-231743507 AGAGTGCCTGCAATGTGATGAGG + Intronic
948223443 2:236291063-236291085 AGGGTGGCTGCTTTTTGATGTGG + Intergenic
1169695669 20:8384789-8384811 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1170496682 20:16931401-16931423 TGGGTGCCTGCTCTTTCCTCTGG - Intergenic
1170884847 20:20331237-20331259 AGGATTCCTGCACTCTTCTGTGG + Intronic
1171420500 20:25014290-25014312 AGGGGGCCTGCACCTGGCTGTGG - Intronic
1172028521 20:31966185-31966207 AGGCTGCCTTCACTTGGATGGGG + Intergenic
1173411867 20:42818253-42818275 AGGGCTTCTGCAGTTTGCTGGGG - Intronic
1174564804 20:51456981-51457003 AGGGTGCCTGGGCTGAGCTGGGG - Intronic
1174953242 20:55066708-55066730 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1174955201 20:55090255-55090277 GAGGTGCCTGCACCTAGCTGTGG - Intergenic
1176819339 21:13642266-13642288 AGGGTGGCTGTTCTGTGCTGAGG - Intergenic
1177009735 21:15717338-15717360 AAGGTGCCTGCACTTTGTAGAGG - Intergenic
1177912638 21:27051539-27051561 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1178076060 21:29014122-29014144 ATGGTGCCTGCATTTTGCAAGGG + Intronic
1178742357 21:35213803-35213825 AAGGTGCCTGCATTTTGCATAGG + Intronic
1180152451 21:45957305-45957327 AGCATGCCTGCTCTTTGCTTTGG - Intergenic
1180250270 21:46581698-46581720 AGGGTTGCTGCAGTTTGCTGGGG + Intergenic
1181496875 22:23292166-23292188 AGGATGGCTGCCCTCTGCTGTGG + Intronic
1182051099 22:27313337-27313359 AAGCTGGCTGCCCTTTGCTGGGG - Intergenic
1182195025 22:28506797-28506819 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1182727129 22:32456840-32456862 TGGGTGACTGCATTTTTCTGAGG - Intronic
1184370106 22:44076720-44076742 AGGGTGCCTGCCCCTTTCTCAGG + Intronic
1184809618 22:46822505-46822527 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1185068110 22:48642065-48642087 GAGGGGCCTGCACTTTTCTGAGG + Intronic
949119827 3:372865-372887 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
949592806 3:5511085-5511107 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
950947082 3:16960297-16960319 AGTGTGGCGGCACTGTGCTGGGG - Intronic
951084491 3:18495196-18495218 TGGATGCCTGCATTTTTCTGAGG - Intergenic
951432768 3:22627766-22627788 AGGGCTGCTGCTCTTTGCTGGGG + Intergenic
951996491 3:28736026-28736048 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
952377280 3:32778305-32778327 ACCGTGCCTGGCCTTTGCTGGGG + Intergenic
953159087 3:40401512-40401534 AGCATGCCTGCCTTTTGCTGTGG + Intronic
954690883 3:52395054-52395076 AGGGTTCCAGCACTTGCCTGGGG - Exonic
955505945 3:59633290-59633312 AGGATCCCTGCACTCAGCTGTGG + Intergenic
955681294 3:61504946-61504968 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
957268791 3:78002803-78002825 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
957434032 3:80151562-80151584 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
957584239 3:82114139-82114161 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
958950222 3:100408512-100408534 AGGGGGCCTGCCTGTTGCTGTGG + Intronic
959333559 3:105036618-105036640 AGCGTGCCTGGAATATGCTGGGG + Intergenic
960218938 3:115079890-115079912 AGAGTGCCTACAATGTGCTGGGG + Intronic
960565433 3:119126750-119126772 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
960758721 3:121049178-121049200 AAGGTGGCTGCACTGTGCTAGGG + Intronic
961589666 3:127967953-127967975 AGCATGCCTGCTCTTTGCTGTGG - Intronic
961684501 3:128620361-128620383 AGGGTGCCTGCACTTTGCTGTGG - Exonic
962984365 3:140521375-140521397 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
963009382 3:140754986-140755008 AGGGAGCCAGCACTGTGCTGGGG + Intergenic
964007663 3:151851531-151851553 AGGGCTACTGCAGTTTGCTGGGG + Intergenic
965058340 3:163750003-163750025 GGGGTGGTTGCACTGTGCTGGGG - Intergenic
965197947 3:165623881-165623903 AGGGAACCTGGACTTTACTGAGG + Intergenic
965698784 3:171438313-171438335 AGGGGTCCTGCACTTTGTTAAGG + Intronic
966151944 3:176875244-176875266 AGAGTTGCTGCACTGTGCTGGGG + Intergenic
966250410 3:177859709-177859731 AGGGCTGCTGCATTTTGCTGGGG + Intergenic
966454865 3:180102988-180103010 AGGGTTGCTGCAGTGTGCTGGGG - Intergenic
966539536 3:181074620-181074642 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
968437072 4:599175-599197 AAGATGGCTGCAGTTTGCTGGGG + Intergenic
968494930 4:910306-910328 AGGGGGACTGCACTTAGCGGGGG - Intronic
968692213 4:1998015-1998037 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
970155203 4:13134202-13134224 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
970288036 4:14539802-14539824 AGGGCTACTGCAGTTTGCTGGGG - Intergenic
970745636 4:19291690-19291712 AGTTTGCATGCACTTTGTTGAGG + Intergenic
971516736 4:27496680-27496702 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
971574350 4:28254380-28254402 AGGGCTTCTGCAGTTTGCTGGGG - Intergenic
972022039 4:34327227-34327249 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
974012616 4:56620733-56620755 AGGCTGCATGCATTCTGCTGTGG + Intergenic
974112959 4:57546667-57546689 AGGGGGCCAGCACTTTGGAGAGG + Intergenic
976538109 4:86242114-86242136 AGGGCTCCTGCAGTTTGCTGGGG + Intronic
976807322 4:89063038-89063060 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
977508926 4:97937744-97937766 TGGGTGCCTGCTCTTTCCTCTGG + Intronic
977657170 4:99535977-99535999 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
978327997 4:107580069-107580091 AGGGTTGCTGCAGTTTGCTGGGG - Intergenic
978656933 4:111075422-111075444 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
979097029 4:116563567-116563589 AGGGTGGCTGTAGTTTGCTCGGG - Intergenic
979197743 4:117941061-117941083 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
979576205 4:122294500-122294522 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
979628326 4:122871731-122871753 AGGGCTTCTGCAGTTTGCTGGGG - Intronic
979775539 4:124583943-124583965 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
980104900 4:128578313-128578335 AGGGGGCATGGACTTTGCAGAGG - Intergenic
980508823 4:133759255-133759277 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
981733632 4:147926038-147926060 AGGGTGCTTCCACCATGCTGGGG + Intronic
981944316 4:150323568-150323590 ATGGTGTCTGCAGCTTGCTGTGG - Intronic
982372393 4:154647764-154647786 AGGGCTACTGCAGTTTGCTGGGG - Intronic
982956152 4:161769432-161769454 AGTGTGCCAGTATTTTGCTGAGG - Intronic
983106221 4:163690024-163690046 TGGGAGCCTGTACTTGGCTGGGG + Intronic
983376517 4:166935270-166935292 AGCAAGCCTGCCCTTTGCTGAGG - Intronic
983511454 4:168613370-168613392 ACGGTGCATGCTCTTTGATGCGG - Intronic
983666279 4:170188301-170188323 AGTGTGCATACACTCTGCTGTGG + Intergenic
983774811 4:171594290-171594312 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
983899047 4:173113514-173113536 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
983957689 4:173716440-173716462 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
984335112 4:178379839-178379861 AGGGCTGCTGCAGTTTGCTGTGG - Intergenic
984626009 4:182008997-182009019 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
984723437 4:182998221-182998243 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
985583671 5:714728-714750 TGGGAGCTTGCTCTTTGCTGTGG + Intronic
985586587 5:741612-741634 AGGGCGCCAGCTCCTTGCTGTGG + Exonic
985597180 5:799025-799047 TGGGAGCTTGCTCTTTGCTGTGG + Intronic
985601174 5:833791-833813 AGGGCGCCAGCTCCTTGCTGTGG + Exonic
985647005 5:1089705-1089727 AGGCTGCCTGCTCCGTGCTGGGG - Intronic
986006211 5:3671337-3671359 TGTGTGCCAGCACTGTGCTGAGG + Intergenic
986140754 5:5027090-5027112 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
986492524 5:8307193-8307215 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
987453964 5:18120082-18120104 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
987530712 5:19115458-19115480 AGGGATGCTGCAGTTTGCTGGGG - Intergenic
987988487 5:25180727-25180749 AGGGCTGCTGCAGTTTGCTGAGG + Intergenic
988076488 5:26362020-26362042 AGGGTTGCTGCAGTATGCTGGGG + Intergenic
988870672 5:35385528-35385550 AGGGAGCCTCCCCTTTGCAGTGG + Intergenic
989305539 5:39951086-39951108 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
989676582 5:43981003-43981025 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
990138991 5:52681947-52681969 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
992472903 5:77076185-77076207 AGGGAGACTGCACATTGCTGAGG + Exonic
993226169 5:85168866-85168888 AGGGTAGCTGTGCTTTGCTGGGG + Intergenic
993253454 5:85556882-85556904 AGGGCAGCTGCAGTTTGCTGGGG - Intergenic
993589684 5:89778614-89778636 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
994107854 5:95966370-95966392 AGGGAGGCTTGACTTTGCTGAGG - Intergenic
994298894 5:98122264-98122286 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
994344619 5:98669475-98669497 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
994843065 5:104951301-104951323 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
995003107 5:107158633-107158655 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
995052320 5:107720110-107720132 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
995102048 5:108323810-108323832 AGGGTGCCGGCACTATTCAGTGG + Intronic
995258213 5:110072163-110072185 AGGGTTGCTGCAGTTTGCTGGGG + Intergenic
995612420 5:113924238-113924260 AGAGTGCCTGAACTCTGCTAAGG + Intergenic
996437358 5:123449583-123449605 AGCATGCCTGCCCTTTGCTTTGG + Intergenic
996463125 5:123770311-123770333 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
996639183 5:125731148-125731170 AGGGCTGCTGCAGTTTGCTGCGG - Intergenic
996778526 5:127159347-127159369 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
996893935 5:128456673-128456695 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
997099512 5:130953656-130953678 AGCCTGCCTGCCCTTTGCTTTGG - Intergenic
997243836 5:132329308-132329330 AGGGGGCTTGCGCTTTCCTGAGG + Intronic
997267141 5:132501440-132501462 AGGGTGCAGGCACAATGCTGCGG + Intergenic
997955228 5:138274167-138274189 AGGGTGCCTGCAAGGGGCTGGGG - Intronic
999956032 5:156702869-156702891 AGCATGGCTGCACTTTGCTCTGG - Intronic
1000244479 5:159438002-159438024 AGGATGCCTGCCCTCTGGTGAGG - Intergenic
1001788925 5:174437667-174437689 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1003686993 6:8314601-8314623 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1004502902 6:16224996-16225018 AGGGTGCCTCCCTTTTACTGAGG - Intergenic
1005348513 6:24912228-24912250 GGAGTGCCTGCTCTGTGCTGGGG - Intronic
1005670387 6:28099598-28099620 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1006040279 6:31246764-31246786 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
1006520450 6:34568301-34568323 AGGATGGATGGACTTTGCTGGGG + Intergenic
1006712261 6:36084081-36084103 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1007962025 6:45968559-45968581 AGAGTGCCTGCCCTTTGGTCTGG - Intronic
1008773549 6:55008653-55008675 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1010483121 6:76378732-76378754 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1011137690 6:84117730-84117752 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1011321194 6:86095135-86095157 AGGGGTGCTGCAGTTTGCTGGGG - Intergenic
1011459027 6:87584091-87584113 AGCATGCCTGCCCTTTGCTCTGG - Intronic
1012213252 6:96550647-96550669 AGGGGGCCAGCACCTTGCTGGGG - Intronic
1012252218 6:96991900-96991922 AAGGTGGCTGCGCTGTGCTGGGG + Intronic
1012746639 6:103099255-103099277 AGTTTGCCAGCATTTTGCTGAGG - Intergenic
1013379825 6:109557254-109557276 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1013394680 6:109723277-109723299 AGGTTCCCTGAACTTTGCTTTGG - Intronic
1013420012 6:109959074-109959096 AGAGTGACTGTACTGTGCTGAGG + Intergenic
1014084871 6:117330704-117330726 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1014364814 6:120525933-120525955 AGTTTGCCTGCATTTTGTTGAGG + Intergenic
1014864122 6:126506438-126506460 AGGGCTACTGCAGTTTGCTGGGG - Intergenic
1016431984 6:143994999-143995021 AGGGTGCCTGCTCTTTGTGATGG - Intronic
1018493191 6:164318443-164318465 AGCATGCCTGCACTTTGCTCTGG + Intergenic
1018578351 6:165283706-165283728 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1019113434 6:169737577-169737599 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1019298900 7:293458-293480 TGAGTTCCTGCACTTTGCTCTGG + Intergenic
1019354243 7:570574-570596 AGGGTGACTGCCCTGTGCTGTGG + Intronic
1019534090 7:1519062-1519084 TGGGGGCCTTCACTTGGCTGAGG - Intergenic
1019577658 7:1745322-1745344 AGACTGACTGCAGTTTGCTGAGG - Exonic
1021571304 7:22067979-22068001 GAGGTGCCTTCCCTTTGCTGCGG + Intergenic
1021776611 7:24060302-24060324 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
1022677853 7:32516550-32516572 AGGGCTGCTGCACGTTGCTGGGG - Intronic
1023828090 7:44023309-44023331 AGGGTGCCTGCCCTGCCCTGTGG + Intergenic
1024689111 7:51780313-51780335 AGGATGACTGCACTTAGCTTTGG - Intergenic
1025041798 7:55651877-55651899 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1028644253 7:93077246-93077268 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1029039591 7:97558401-97558423 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1029756391 7:102576748-102576770 AGGGTGCCTGCCCTGCCCTGTGG + Intronic
1029774334 7:102675827-102675849 AGGGTGCCTGCCCTGCCCTGTGG + Intergenic
1030413526 7:109212624-109212646 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1030830131 7:114210399-114210421 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1033708340 7:143910638-143910660 AGGGGGCCGGAGCTTTGCTGTGG + Intergenic
1038388414 8:27171905-27171927 GATCTGCCTGCACTTTGCTGTGG + Intergenic
1038706818 8:29901925-29901947 AGGGATGCTGCAGTTTGCTGGGG - Intergenic
1039265243 8:35816478-35816500 TGGGTGCCTGCTCTTTCCTCTGG - Intergenic
1039550528 8:38439967-38439989 AGGATGCCTGGATTTTGTTGGGG - Intronic
1039637019 8:39178786-39178808 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1039685823 8:39801278-39801300 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1040400724 8:47046547-47046569 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1040404771 8:47088857-47088879 AGGGTGGCTGTGCTGTGCTGGGG + Intergenic
1040614090 8:49017810-49017832 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1041012620 8:53559245-53559267 AGGGCGGCTGCACTGCGCTGGGG - Intergenic
1041181045 8:55248320-55248342 AGGATGAATGCACTTTGGTGGGG - Intronic
1041747499 8:61224434-61224456 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1042012276 8:64260519-64260541 AACGTGGCTGCACTTTGCAGCGG - Intergenic
1042630055 8:70806142-70806164 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1042644257 8:70968698-70968720 AGGGCTTCTGCAGTTTGCTGGGG + Intergenic
1043223748 8:77698970-77698992 AGGGCTGCTGCAATTTGCTGGGG + Intergenic
1044505084 8:93007231-93007253 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1044573402 8:93743907-93743929 ATGGTGGCTGCACTGAGCTGTGG + Intergenic
1044587884 8:93884984-93885006 AGGGTCCGTGAACTTTGCCGGGG + Intronic
1046255773 8:111694539-111694561 AGGGTGGCTGTTCTGTGCTGGGG + Intergenic
1046416240 8:113917226-113917248 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1047151998 8:122274157-122274179 TGGGTGCCTGCACCTTCCTCTGG - Intergenic
1048307037 8:133291710-133291732 AGGGCCCCTGTACTTTGCAGTGG + Intronic
1050284060 9:4082534-4082556 AGCATGCCTGCAGCTTGCTGAGG - Intronic
1051036066 9:12747007-12747029 AGGGCTGCTGCAGTTTGCTGAGG + Intergenic
1051475177 9:17498830-17498852 AGGGTGCAAGATCTTTGCTGTGG + Intronic
1051603556 9:18897604-18897626 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1052225185 9:26077403-26077425 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1052420892 9:28241850-28241872 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1055748575 9:79478569-79478591 AGGGACTCTGCAGTTTGCTGGGG + Intergenic
1055842206 9:80519051-80519073 AGGGATCCTGCTGTTTGCTGGGG + Intergenic
1056489231 9:87088438-87088460 GGGCTGGCTGCACTTGGCTGGGG - Intergenic
1057241564 9:93416420-93416442 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1057337551 9:94166998-94167020 AGGGAGGCTGCACTTGGCCGCGG - Intergenic
1058514205 9:105752560-105752582 AGGGTTGCTGCGGTTTGCTGAGG - Intronic
1059260724 9:112973720-112973742 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1059262609 9:112993333-112993355 AGGGCTACTGCAATTTGCTGGGG + Intergenic
1059509901 9:114835682-114835704 AGGGTGGCTGTGGTTTGCTGGGG + Intergenic
1059691075 9:116686959-116686981 AAGGTGCCAACGCTTTGCTGAGG + Intronic
1059895218 9:118856377-118856399 TGGGTGCCTGCTCTTTTCTCTGG - Intergenic
1060110813 9:120905082-120905104 TGGGTGACTGCAGTTTGCTGAGG + Exonic
1061385216 9:130285594-130285616 GGGTTGCCTGGACTTTGATGGGG - Intronic
1062348823 9:136128794-136128816 TGGCTGCCTGCACCTGGCTGCGG - Intergenic
1062429946 9:136522555-136522577 AGGGTGCCTGCACTGGGGGGAGG + Intronic
1062508262 9:136889473-136889495 AGGGTTTCTCCACTTTGGTGAGG + Intronic
1203528019 Un_GL000213v1:107304-107326 AGGGTGGCTGTTCTGTGCTGAGG + Intergenic
1185846177 X:3440481-3440503 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1186290611 X:8093710-8093732 GAGGAGCCTGCAGTTTGCTGTGG + Intergenic
1187887865 X:23906377-23906399 AGGATCCCTGAACTTTGATGGGG - Intronic
1187932725 X:24308430-24308452 ATGGTGCCTGCACTTTTAAGAGG - Intergenic
1188099823 X:26070784-26070806 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1188744745 X:33829045-33829067 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1188791575 X:34413161-34413183 AGGGTTGCTGCAGTATGCTGGGG - Intergenic
1191019305 X:55842532-55842554 AGGGTGGCTGCACTGTGCTGGGG + Intergenic
1191078793 X:56487050-56487072 AGGGCTGCTGCAGTTTGCTGAGG + Intergenic
1191156932 X:57283989-57284011 AAGGTGACTGCGCTGTGCTGTGG + Intergenic
1192718534 X:73668601-73668623 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1192760214 X:74088559-74088581 GGGGTGGCTGCATTTTGCTCAGG - Intergenic
1192830075 X:74742023-74742045 AGGCTGCCTTCATTTTGCTCTGG + Exonic
1193039388 X:76988217-76988239 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1193073468 X:77331934-77331956 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1193125613 X:77867223-77867245 AGTGTGCCTCCCCTTTGCTGTGG - Intronic
1193270866 X:79529680-79529702 AGGGCTTCTGCAGTTTGCTGGGG + Intergenic
1193719408 X:84970921-84970943 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1194263902 X:91733056-91733078 AGGGCTTCTGCAGTTTGCTGGGG + Intergenic
1194444870 X:93975429-93975451 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1195979255 X:110560677-110560699 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1196234402 X:113261887-113261909 GGGATGGCTGCACTGTGCTGGGG + Intergenic
1196284413 X:113863332-113863354 AGGGCTCCTGCGCTTTGCTGGGG + Intergenic
1196517175 X:116628034-116628056 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1196582298 X:117392425-117392447 AGGGTTGCTGCAGTATGCTGGGG - Intergenic
1196582328 X:117392587-117392609 AGGGTTGCTGCAGTATGCTGGGG - Intergenic
1196607253 X:117671254-117671276 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1197046379 X:122003603-122003625 AGGGCTCCTGCAGTTTTCTGGGG + Intergenic
1197122229 X:122906335-122906357 AGGGTACCTGTGCTGTGCTGGGG - Intergenic
1197403832 X:126026993-126027015 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1197428175 X:126323820-126323842 AGGGCTGCTGCATTTTGCTGGGG - Intergenic
1197602043 X:128542891-128542913 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1197606995 X:128596938-128596960 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1200091907 X:153639991-153640013 ACGGGAGCTGCACTTTGCTGGGG - Intergenic
1200103425 X:153699788-153699810 AGGGTGGAAGCACTGTGCTGCGG + Intergenic
1200807727 Y:7449325-7449347 AAGGTGCCTGCATTATGCTTGGG - Intergenic
1200818328 Y:7555921-7555943 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1200932724 Y:8711686-8711708 AGGCTGTTTGCACTTTGCAGTGG - Intergenic
1201921051 Y:19233461-19233483 AGGGTACCTGGACCTTCCTGGGG - Intergenic
1201936046 Y:19411923-19411945 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1202180818 Y:22138477-22138499 AGGTTGTTTGCACTTTGCAGGGG - Intergenic
1202210542 Y:22447923-22447945 AGGTTGTTTGCACTTTGCAGGGG + Intergenic