ID: 961684811

View in Genome Browser
Species Human (GRCh38)
Location 3:128622444-128622466
Sequence GGTCAGAGTGGACCCAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961684811 Original CRISPR GGTCAGAGTGGACCCAAGCC TGG (reversed) Intronic
900243585 1:1627879-1627901 GGGCAGAGGGAACCCAGGCCAGG - Intronic
900245837 1:1635740-1635762 GGTCAGAGTGGACCCCGTCATGG - Exonic
900257062 1:1702883-1702905 GGTCAGAGTGGACCCCGTCATGG - Exonic
900550092 1:3250274-3250296 GGTCAGAGTCCACCCAGGGCCGG - Intronic
900696970 1:4018506-4018528 AGTCAGAGTGCATCCAAGTCAGG + Intergenic
900802695 1:4747234-4747256 GGCCAGAGTGCAGCCAAGTCAGG - Intronic
903359115 1:22765888-22765910 GGGCAGAGGGGACAGAAGCCAGG + Intronic
903904070 1:26671165-26671187 GGTGAGAGTGCACTCCAGCCTGG - Intergenic
904078591 1:27858040-27858062 GGGCAGAGTGGACTAAAGTCTGG + Intergenic
904700173 1:32353245-32353267 GGTCAGGGTGTGCCTAAGCCTGG - Intronic
907185401 1:52605228-52605250 GGTGAGAAAGGACCCATGCCTGG - Intronic
907847042 1:58218363-58218385 GGTCAGGGTTGAGCCAAGCCAGG + Intronic
909051302 1:70771925-70771947 TGTGGGAGTGGACCCAAGCATGG + Intergenic
909091649 1:71233284-71233306 CCTCAGTGTGGACCAAAGCCTGG + Intergenic
912156622 1:106929043-106929065 GGACAGAGTGGAGCCAATCTTGG - Intergenic
912381144 1:109248950-109248972 GGTCAGAGTGGGTGGAAGCCAGG - Intergenic
913965837 1:143377014-143377036 GGTCAGAGTGGGCACAGTCCTGG + Intergenic
915331387 1:155114889-155114911 GGTCTGAGTGCACTCCAGCCTGG - Intergenic
915726216 1:158019546-158019568 GGTCAGTGTGGAGCTCAGCCTGG - Intronic
916577513 1:166080886-166080908 GGTCAGAGGGGAGCCAGGCCAGG + Intronic
916639833 1:166715944-166715966 GGTGGGAGTGGGCCCAAGCACGG - Intergenic
917051749 1:170932274-170932296 GGGCAGTGGGGCCCCAAGCCTGG + Intergenic
917232999 1:172857971-172857993 GGTGAGAGAGGACCAGAGCCAGG - Intergenic
919934989 1:202245447-202245469 GGACAGAGTTGGCCCAAGTCGGG + Intronic
922162913 1:223091309-223091331 GGAGAGAGTTGACCCCAGCCTGG - Intergenic
922822781 1:228495312-228495334 GGTCAGAGAGGAACCCAGTCAGG + Exonic
923558220 1:235018563-235018585 GGTCAAAGTAGTCTCAAGCCTGG + Intergenic
923724762 1:236496445-236496467 GCTGAGACTGAACCCAAGCCAGG + Intergenic
1066410233 10:35161448-35161470 GGTCCCAGTGGACTCCAGCCTGG + Intronic
1067945804 10:50687240-50687262 GGCCAGAGAGGACCCAAACATGG - Intergenic
1069564123 10:69451758-69451780 GCTAAGTGTGGACCCAACCCCGG - Intronic
1070279108 10:75036035-75036057 GGTCATAGTGGCCCCAACCTAGG - Intergenic
1070867320 10:79714113-79714135 GGCCAGAGAGGACCCAAACATGG - Intronic
1070881112 10:79852237-79852259 GGCCAGAGAGGACCCAAACATGG - Intergenic
1071634235 10:87236336-87236358 GGCCAGAGAGGACCCAAACATGG - Intronic
1071647685 10:87368553-87368575 GGCCAGAGAGGACCCAAACATGG - Intronic
1073645138 10:105293891-105293913 GGTCAGAGTGGAGCCAGGTGAGG - Intergenic
1074125783 10:110527936-110527958 GGTCAGGGAGGAACCAACCCAGG - Intergenic
1074214678 10:111372813-111372835 GGTCAGAGTGGAACCAAAGATGG + Intergenic
1074586160 10:114768821-114768843 GTTCAGAGTGGTCACCAGCCCGG - Intergenic
1074777108 10:116774781-116774803 GGTCAGGGTGGAGTCAGGCCAGG - Intergenic
1077071422 11:675774-675796 GGTGCCAGTGGACTCAAGCCTGG + Intronic
1077399963 11:2350075-2350097 GGGCAGAGTGGCCCAAGGCCTGG + Intergenic
1077558228 11:3237840-3237862 GGTCACAATGGACCCAGGACAGG - Intergenic
1081551793 11:44120397-44120419 GGACAGCATGGGCCCAAGCCAGG - Intronic
1084047503 11:66578284-66578306 TTTAAGAGTGGTCCCAAGCCAGG + Intergenic
1084180025 11:67441572-67441594 GGGCAGAGTGGGCCTCAGCCTGG - Intronic
1085193329 11:74648440-74648462 GGTCAGTGTGGTCCCAAGAAAGG + Intronic
1087008648 11:93493261-93493283 GGCCTGAGTGGACCTAAGACTGG - Intronic
1087798169 11:102476247-102476269 GTCAGGAGTGGACCCAAGCCTGG - Intronic
1089576576 11:119448549-119448571 GGTCACAGTAGAGCCAAGGCCGG + Intergenic
1089893527 11:121904704-121904726 GGTCAGAGTTGAGGCCAGCCTGG - Intergenic
1091750725 12:3019900-3019922 GGTCAGTGTGGACAGAAGACTGG - Intronic
1095942731 12:47737364-47737386 CCTCGGAGTGGACCCGAGCCAGG - Exonic
1095970945 12:47901750-47901772 GTTCATAGTGGAGCCAAGACTGG - Intronic
1096252353 12:50041209-50041231 GGTCAGAATGGAGCCCATCCTGG + Intergenic
1097198179 12:57256052-57256074 GGACAGAGTGGACTGAAGCATGG - Exonic
1097447078 12:59684657-59684679 GGGCAGAGTGGAACCCAGTCAGG + Intronic
1097986126 12:65785229-65785251 TGTCCCAGTGGACCCAAACCAGG + Intergenic
1101441670 12:104708673-104708695 TGTCAGAGGGGAGCCCAGCCTGG - Intronic
1105326224 13:19372692-19372714 GGTCAGAGTGGGCCCAGGGGTGG - Intergenic
1105867282 13:24472377-24472399 GGTCAGAGTGGGCCCAGGGGTGG + Intronic
1108454225 13:50597120-50597142 GCTCACAGTGGAGCCAAGCAGGG - Intronic
1108521599 13:51251571-51251593 GGTCGGGGTGGATCCACGCCAGG - Exonic
1108896450 13:55334743-55334765 GGACAGAGTTGCCCAAAGCCTGG + Intergenic
1109219501 13:59627100-59627122 GGTCAGAGTGGGGCCATGGCAGG - Intergenic
1115441423 14:33440320-33440342 GCTCAGGGTGGTCTCAAGCCTGG + Intronic
1115651083 14:35403655-35403677 GGTCAGAGAGAACCCGGGCCAGG + Intronic
1116612458 14:47093164-47093186 AGCCAAAGTGGACCCAAGCTGGG + Intronic
1122873438 14:104651736-104651758 TGTCAGAGGGAACCCAGGCCCGG - Intergenic
1123029929 14:105446781-105446803 GTCCAGAGTGGACCCAGGCTCGG - Intronic
1125605049 15:40935371-40935393 GGTCAGAGGCCACCCCAGCCAGG - Intronic
1126213963 15:46132735-46132757 GGTCAGACTGGCCCCATCCCAGG + Intergenic
1127877328 15:63122293-63122315 GGGCTGAGTGGACCCCACCCGGG + Intronic
1128536900 15:68498409-68498431 GGTCAGAGTAGACAGAACCCTGG + Intergenic
1129724758 15:77896102-77896124 GGTCAGACTTGTCCTAAGCCAGG + Intergenic
1131066452 15:89437722-89437744 GGTGAGAGTTGAGCCAACCCAGG - Intergenic
1131157359 15:90083479-90083501 GGTGAAAGTGAACCCAAGCCTGG + Exonic
1131622536 15:94082812-94082834 GGGCAGAGGAGACCCGAGCCCGG + Intergenic
1132692460 16:1187687-1187709 GGTCAGAGTGGCCCCCAAGCAGG - Intronic
1132871534 16:2117703-2117725 GGTCAGTGTGGGCCCAAGACGGG + Intronic
1132980579 16:2736907-2736929 GGTCTGAGATGACCCAAGCTGGG + Intergenic
1134520995 16:14919192-14919214 GGTCAGTGTGGGCCCAAGACGGG - Intronic
1134550577 16:15136781-15136803 GGTCAGTGTGGGCCCAAGACGGG + Intronic
1134708671 16:16317843-16317865 GGTCAGTGTGGGCCCAAGACGGG - Intergenic
1134715884 16:16357876-16357898 GGTCAGTGTGGGCCCAAGACGGG - Intergenic
1134950933 16:18350802-18350824 GGTCAGTGTGGGCCCAAGACGGG + Intergenic
1134958872 16:18394283-18394305 GGTCAGTGTGGGCCCAAAACGGG + Intergenic
1135671221 16:24377165-24377187 GGTCAGAGAGGAGTCAAGACTGG - Intergenic
1136111562 16:28066701-28066723 GGGCAGAGGGGACCCATGTCTGG + Intergenic
1137715567 16:50596195-50596217 GGTCTGGGTGGACCAAAGTCTGG + Intronic
1138089021 16:54159108-54159130 GCTCAGAGAGGAACCAAGGCAGG - Intergenic
1138298373 16:55906408-55906430 GGTCACAGAGGAGCCAAGCCAGG + Intronic
1141504428 16:84465298-84465320 GGTCAGAGTGGACCCCTGCCAGG + Intergenic
1142133647 16:88442078-88442100 GGTCAGAGTAGACCCCTGACTGG + Intergenic
1143306886 17:5954434-5954456 GGTCCCAGTTGTCCCAAGCCAGG - Intronic
1145900489 17:28487753-28487775 GGTCAAAGTGGCCCCAATCCTGG + Intronic
1145993160 17:29091257-29091279 GGGCAGAGTGCACGCAGGCCAGG - Intronic
1149424259 17:56539840-56539862 GGTCAGAGTAGACTCAAGGAAGG + Intergenic
1149545591 17:57501216-57501238 GGTCAGCTTGGACCCTAGCAGGG - Intronic
1152167435 17:78719175-78719197 GGTGAGTGTGGCCCCAAGCTAGG - Intronic
1152591268 17:81213808-81213830 GGACAGTGTGGACCCCAGACAGG + Intronic
1156844495 18:41648612-41648634 GGTCAGAGTGGAAGCAAACCAGG - Intergenic
1157804274 18:50646495-50646517 GAGCAGAGTGGCACCAAGCCTGG + Intronic
1159043965 18:63351034-63351056 GGGCAGCGTGTACCCCAGCCGGG - Exonic
1160924196 19:1535261-1535283 GGTCAGAGTGGACCCCTGCATGG + Exonic
1162027580 19:7903274-7903296 GCTCAGAGTTGGCCGAAGCCAGG - Intergenic
1162524005 19:11197181-11197203 GGGCAGAGGGGAGCCAAGACAGG + Intronic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1163627056 19:18396323-18396345 GCTCAGGATGGGCCCAAGCCCGG - Exonic
1163676996 19:18660280-18660302 TGTCAGAATGGCCCCTAGCCCGG + Intronic
1165573527 19:36795215-36795237 GGTCTGAGAGGACCCAGGCGGGG + Intergenic
1166353902 19:42215981-42216003 GAGCAGAGGGGACCCAAGCTAGG - Intronic
1168557963 19:57359231-57359253 GGTCAGAGAAGACCCATCCCTGG - Exonic
926058752 2:9792257-9792279 GGGCTGAGTGGACACAACCCAGG + Intergenic
927416883 2:22889376-22889398 GGTCAGAGGGGTCCCAGGCTTGG - Intergenic
928453999 2:31403120-31403142 GGGCTGAGTGGAACCAAGCTCGG - Exonic
929265764 2:39917552-39917574 GGTCAGAGTGAGCACAAGCAGGG - Intergenic
932558984 2:72850763-72850785 TGTCAGTGTGGACCCCATCCCGG - Intergenic
932569999 2:72933637-72933659 GGTCAGAGGGGACCCCGGCCTGG + Intronic
936261130 2:110960212-110960234 GGCCAGAATGAACCCAAGCAAGG + Intronic
937516397 2:122660822-122660844 GGACAGAGAGGACCGCAGCCTGG - Intergenic
938135224 2:128751059-128751081 CGTGAGAGTGGACCCAAGAGGGG + Intergenic
945142319 2:206699836-206699858 GCTCAGATTGGACCCAAGACAGG + Exonic
948805227 2:240451031-240451053 GGTCATGGTGGTCCCAGGCCTGG - Intronic
948997718 2:241592185-241592207 GCTCAGAGAGGCCCCCAGCCTGG - Intronic
1170545374 20:17431610-17431632 GGTCACAGGGGAGCCAAGCTGGG - Intronic
1171205247 20:23273980-23274002 GGGCACAGTGGGCCCAAGCCTGG + Intergenic
1172781144 20:37437655-37437677 GGCCAGAGTGGAGCCTGGCCAGG - Intergenic
1172786953 20:37474705-37474727 GGTAAGAGTGGATCCAAGCAGGG - Intergenic
1174377130 20:50133538-50133560 GGGGAGGGTGGACCCAGGCCAGG + Intronic
1174403681 20:50290188-50290210 GGTCAGACTGGACCCAAAAGAGG + Intergenic
1174499783 20:50976108-50976130 GGGCAGAGTGGAGCCCATCCTGG + Intergenic
1175967005 20:62664786-62664808 GGTCAGAGTGGGCCAGACCCAGG - Intronic
1180116030 21:45705601-45705623 TGTCAGTGTGGACCCAAACAGGG + Intronic
1180881233 22:19204868-19204890 GTTCATAGTGGCCCCAGGCCTGG - Intronic
1181106063 22:20576421-20576443 GGTCCATGTGGCCCCAAGCCTGG + Intronic
1181345179 22:22214852-22214874 GGTGAGAGTGGACCTTACCCAGG + Intergenic
1182041559 22:27242255-27242277 GGTCTGTGTGGCCCCATGCCCGG - Intergenic
1182320623 22:29476644-29476666 TGTCAGAGGGTACCCAGGCCGGG + Intergenic
1183676462 22:39301582-39301604 GGTGACATTGGAGCCAAGCCCGG + Intergenic
1184095684 22:42315095-42315117 GGTCTGAGGAGACCCAAGCAGGG + Intronic
1185279252 22:49962901-49962923 GGTCAGGGAGGGCCCAAGCAGGG - Intronic
1185415984 22:50710497-50710519 GGTCAGTGGAGACCCAGGCCAGG + Intergenic
950160115 3:10754135-10754157 GGGCACAGAGAACCCAAGCCAGG + Intergenic
951711170 3:25585937-25585959 GGTCAGTGTGGAGCCAGGACTGG + Intronic
953091198 3:39727466-39727488 GGGCAGAGTGAAGTCAAGCCTGG - Intergenic
953320154 3:41964084-41964106 GGGCAGAGGGGAGCCGAGCCAGG + Intergenic
954713277 3:52515283-52515305 GGTCAGAGAGGGACCAAGACAGG - Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961103978 3:124225472-124225494 GGTCAGGGAGGACCCTGGCCTGG + Intronic
961404349 3:126667886-126667908 GGGCACACAGGACCCAAGCCGGG + Intergenic
961684811 3:128622444-128622466 GGTCAGAGTGGACCCAAGCCTGG - Intronic
962976128 3:140447409-140447431 AGTCAGAGCGGACTCAAGGCAGG - Intronic
964725893 3:159814214-159814236 GTTCAAAGTGGATCCAAGCCGGG - Intronic
968518984 4:1027287-1027309 GGTCAGAGGTGACCTGAGCCTGG - Intergenic
975049045 4:69836925-69836947 GGTCAGGGTTGAACCAAGCATGG + Intronic
979045078 4:115852319-115852341 GGTCTGTGTGGGCCCAAGCCAGG - Intergenic
981925305 4:150132626-150132648 GGTGACACTGCACCCAAGCCTGG - Intronic
983396071 4:167197109-167197131 ACCCAGAGTTGACCCAAGCCTGG - Intronic
983586651 4:169362850-169362872 GGCCAGAGAGGAAGCAAGCCGGG + Intergenic
983939517 4:173525391-173525413 GGTCATAGTGGACACCAGCTAGG + Intronic
985544084 5:500558-500580 GGTCAGTGTGGACACAGGGCCGG + Intronic
985577029 5:678261-678283 GGGCAGAGTGGAGCCAAGCGAGG + Intronic
985591949 5:770314-770336 GGGCAGAGTGGAGCCAAGCGAGG + Intergenic
986775402 5:11009266-11009288 GGGCAGAGTGTACCAGAGCCAGG + Intronic
989160686 5:38387876-38387898 GGTCAGTGAAGACTCAAGCCAGG + Intronic
992173169 5:74124049-74124071 GGTCAGGGTGGGCCCAGGGCAGG - Intergenic
998092969 5:139381717-139381739 GGGCAGCGTGGCCCCAACCCTGG - Intronic
1001534478 5:172488973-172488995 GGTCAGCGTGGGCCCCAGTCTGG + Intergenic
1002319861 5:178368631-178368653 GGGAAGAGTGGGGCCAAGCCTGG + Intronic
1003033207 6:2620669-2620691 GGTCAGTGTGAACCCGGGCCAGG - Intergenic
1003922047 6:10841556-10841578 GGTCAAAGTGGTCCCAGGTCAGG + Intronic
1006052244 6:31354123-31354145 GGTCACAGTGGACACAAGGGTGG + Exonic
1006610734 6:35292807-35292829 GGTGAGAGTGGGGACAAGCCAGG + Intronic
1006740807 6:36307099-36307121 TGCCAGAGTGGTCCCAAGGCAGG - Intronic
1007191217 6:40020503-40020525 GATAAGAGTGGAACCAAGGCAGG + Intergenic
1012525893 6:100177483-100177505 GGTGAGAGGAGACCCCAGCCTGG + Intergenic
1013290565 6:108715737-108715759 GGGCAGAGTGATCCCACGCCAGG + Intergenic
1015135177 6:129861155-129861177 GGTCAGAGTTGCTCCAAGCAAGG - Exonic
1015689182 6:135901918-135901940 GGTCAGACAGGGCCCAAGGCTGG - Intronic
1016814909 6:148294345-148294367 GGTCAGAGTGGTACAAATCCTGG + Intronic
1018067102 6:160131876-160131898 GGTCAGGCTGCACCCAAACCAGG - Intronic
1018903882 6:168064189-168064211 GGTCAGGGTGGGGCCCAGCCAGG - Intronic
1019140396 6:169938851-169938873 GGGGAGAGTGGACCCCAGTCAGG - Intergenic
1020029029 7:4920139-4920161 GCCCAGAGGGGACCCATGCCGGG - Intronic
1023909117 7:44541276-44541298 GGTCAGCGGGGAGCCAGGCCAGG + Exonic
1023992733 7:45139107-45139129 GGTAAGTGTGGAGCCACGCCAGG - Intergenic
1030332083 7:108281727-108281749 GGTCAGAGAAGCCCCAAGCTTGG - Intronic
1032408196 7:131673139-131673161 GGTCAAAGAGGTCCCAGGCCAGG + Intergenic
1035461296 7:159040829-159040851 GGCCAGAGAGGAGCCAAGCTGGG - Intronic
1035469406 7:159100086-159100108 GGTCAATGTGGTCCCCAGCCAGG + Intronic
1036980137 8:13461164-13461186 GGTGCGAGTGCACCCCAGCCTGG + Intronic
1037582676 8:20254884-20254906 GGTCAAAGTCCACCCCAGCCTGG + Exonic
1037880841 8:22572693-22572715 AGTCAGTGGGGACCCAGGCCAGG + Intronic
1039362887 8:36899237-36899259 GATCAGAGTGGCCCCAGCCCAGG - Intronic
1039574521 8:38612666-38612688 TGTCAAAGAGGACCCAGGCCTGG - Intergenic
1039728588 8:40250184-40250206 GGTCAGAGTGGAGGCAAGCAAGG - Intergenic
1044481863 8:92699819-92699841 GGCCAGAGTGGCCCACAGCCGGG - Intergenic
1048440911 8:134458414-134458436 GGTCAGAGAGGTCCCGGGCCAGG + Intergenic
1049336548 8:142089697-142089719 GGTCAGAGGGGGCCCGAGTCAGG - Intergenic
1052741673 9:32399048-32399070 GCTCACAGTGCACCCAAGCATGG + Intronic
1053591299 9:39517254-39517276 GTTCAGAGTGGACCCTTGCAGGG + Intergenic
1053849143 9:42272611-42272633 GTTCAGAGTGGACCCTTGCAGGG + Intergenic
1054575009 9:66848039-66848061 GTTCAGAGTGGACCCTTGCAGGG - Intergenic
1056099956 9:83291827-83291849 GGTCAGAGTGTTCCCTAGACCGG + Intronic
1058670159 9:107354542-107354564 GGTCAGAGTGGAACCATGCATGG + Intergenic
1060112912 9:120919384-120919406 GGTCACAGTGGGCCCTAGCGGGG + Intronic
1060742848 9:126110992-126111014 GGGCAGAGTGAGCCCAAGCTTGG - Intergenic
1061239385 9:129360324-129360346 GGTCTGAGTGGGACCATGCCGGG + Intergenic
1062104995 9:134750493-134750515 AGTCAGAGTGCAACCAGGCCAGG - Intronic
1062532530 9:137008169-137008191 GGGCAGAGGGGACCAGAGCCGGG - Intronic
1187406962 X:19013079-19013101 GGCCCGTGCGGACCCAAGCCTGG + Intronic
1194539942 X:95157301-95157323 CTTCATTGTGGACCCAAGCCTGG - Intergenic
1196301831 X:114057081-114057103 GGACAGAATGGACCCAGGGCAGG + Intergenic
1202114370 Y:21456208-21456230 TCTCAGTCTGGACCCAAGCCTGG + Intergenic
1202165575 Y:21984067-21984089 GGTGAGACTGCACCCCAGCCTGG - Intergenic
1202225782 Y:22602305-22602327 GGTGAGACTGCACCCCAGCCTGG + Intergenic
1202317331 Y:23593356-23593378 GGTGAGACTGCACCCCAGCCTGG - Intergenic
1202553434 Y:26076702-26076724 GGTGAGACTGCACCCCAGCCTGG + Intergenic