ID: 961688131

View in Genome Browser
Species Human (GRCh38)
Location 3:128649772-128649794
Sequence AATGAGAAGCAGCAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 838
Summary {0: 1, 1: 0, 2: 8, 3: 81, 4: 748}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961688125_961688131 -1 Left 961688125 3:128649750-128649772 CCATTTATTGCCGAGGTGTAAGA 0: 1
1: 0
2: 2
3: 14
4: 91
Right 961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG 0: 1
1: 0
2: 8
3: 81
4: 748
961688122_961688131 25 Left 961688122 3:128649724-128649746 CCTGGAAACATTTAAGCCAAACA 0: 1
1: 0
2: 1
3: 17
4: 203
Right 961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG 0: 1
1: 0
2: 8
3: 81
4: 748
961688123_961688131 9 Left 961688123 3:128649740-128649762 CCAAACACAGCCATTTATTGCCG 0: 1
1: 0
2: 0
3: 11
4: 82
Right 961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG 0: 1
1: 0
2: 8
3: 81
4: 748

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961688131 Original CRISPR AATGAGAAGCAGCAGGGGGA AGG Intronic
900304127 1:1994900-1994922 AAAGAGAAGCGGGAGGTGGAGGG + Intronic
900688869 1:3967153-3967175 AATTAGAAGCACCAGGGGACCGG + Intergenic
900877109 1:5350635-5350657 AAGGAGAAGGTGGAGGGGGAGGG + Intergenic
901078979 1:6572953-6572975 AAGGAGGAGCAGCAGTGGGCAGG - Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
902209156 1:14892406-14892428 AAAGAGAGACAGCAGGGGGGAGG - Intronic
902605222 1:17565372-17565394 AATGTTAAGCAGGAGGGAGAAGG - Intronic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
903223782 1:21883742-21883764 AGTGAGACTCAGCAGGGTGAGGG + Intronic
903407458 1:23110147-23110169 AATGAGAGCCAGCATGGTGAAGG - Intronic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904120322 1:28193924-28193946 AATGAGCAGCAGCAGGATGAAGG + Intronic
904585289 1:31576634-31576656 ACAGAGAAGAAACAGGGGGAGGG + Intronic
905121934 1:35688989-35689011 AAAGAGAAAGAGAAGGGGGATGG + Intergenic
905393199 1:37651154-37651176 ATTGTGGAGCAGCAGGTGGAAGG - Intergenic
905589354 1:39149085-39149107 AATGAGGATCAGAAGGGAGAGGG + Intronic
905825773 1:41025011-41025033 AATGAGACACATCAGGGAGAAGG - Intergenic
905930459 1:41783258-41783280 AGTGAGAAGCCACAGGAGGAAGG + Intronic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906191961 1:43904724-43904746 GAAGAGGAGCAGGAGGGGGAGGG - Intronic
906192145 1:43905391-43905413 GAAGAGGAGCAGAAGGGGGAGGG - Intronic
906192324 1:43906042-43906064 GAAGAGGAGCAGGAGGGGGAGGG - Intronic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906477933 1:46182333-46182355 ATGGAGAAGGAGCAGTGGGAGGG + Intronic
907797699 1:57733875-57733897 AAGAAGAAGCAGCACAGGGAAGG + Intronic
907798689 1:57742837-57742859 AGTGAGAAGCACCAGTGTGAAGG + Intronic
908031836 1:60008865-60008887 AATGCCAAGCAGCTGGAGGAAGG - Intronic
908528262 1:65008664-65008686 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
908950416 1:69555243-69555265 AATGAGAAGGAGCTGGACGATGG + Intergenic
909425560 1:75520564-75520586 AATGAGAAAGAGGAGGGGAAAGG + Intronic
909532971 1:76701432-76701454 GATGAGTAGGAGCTGGGGGAAGG + Intergenic
910326551 1:86014889-86014911 TATGCAAAGCAGCAGGGGGAAGG - Intronic
910455691 1:87395186-87395208 CAGGAAAAGCAGCAGTGGGAGGG + Intergenic
911069766 1:93823385-93823407 AATGAGGAGAAGCTGGTGGAAGG + Intronic
911323566 1:96443181-96443203 AATGAGGAGGAGGAGGAGGAGGG - Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
912439560 1:109687957-109687979 AGTGCGAAGCAGCTGCGGGACGG + Intronic
912564983 1:110580944-110580966 AATGAGAGGCAGCAGGGCTCTGG + Intergenic
912575868 1:110672922-110672944 AGTATGAAGCAGCAGGGAGAGGG + Exonic
913433512 1:118822249-118822271 AAAAACAAGCGGCAGGGGGAGGG + Intergenic
913653960 1:120943993-120944015 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
913990679 1:143608968-143608990 AATGAGAAGCAGCAGTCAGGAGG + Intergenic
914121095 1:144783192-144783214 AAGGAGGAGGAGGAGGGGGAAGG + Intergenic
914285635 1:146224379-146224401 AATGAGAGGCAGGGGGTGGATGG + Intronic
914474716 1:148013706-148013728 CAAGAGAAGCAGCAAGGGAAGGG + Intergenic
914546666 1:148675131-148675153 AATGAGAGGCAGGGGGTGGATGG + Intronic
914644153 1:149638161-149638183 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
915218899 1:154358302-154358324 AATGAAAAGCAGCAGGGCACCGG - Intergenic
915218945 1:154358620-154358642 AATGAAAAGCAGCAGAGGCGAGG - Intergenic
915571787 1:156748877-156748899 AAAGAGAAGGTACAGGGGGAAGG + Intronic
915631737 1:157157954-157157976 ACTGGGACCCAGCAGGGGGATGG - Intergenic
915963903 1:160290058-160290080 GAAGAGTAGCTGCAGGGGGAAGG + Exonic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916397278 1:164404977-164404999 AATGAGAAGCAGAAAAGTGAAGG - Intergenic
916477713 1:165185971-165185993 AATGGCCAGCAGGAGGGGGAGGG - Intergenic
919016767 1:192048510-192048532 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919016798 1:192048676-192048698 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919516413 1:198531137-198531159 AATGAGAACCAGCAGGTGACTGG - Intronic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
920646496 1:207807749-207807771 AGTGAGTAGCAGGAGGAGGAAGG + Intergenic
920704112 1:208239498-208239520 AAAGAAAACCAGCAGGTGGATGG - Intronic
920965133 1:210694983-210695005 AATGAGAAAGGGAAGGGGGATGG + Intronic
921123066 1:212153406-212153428 AATGAGGGGCAGGAGGTGGAGGG - Intergenic
921249374 1:213281960-213281982 AAAGAGACGGAGCAAGGGGAGGG - Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921472586 1:215567284-215567306 AATGAGGAGGAGGAGGAGGAAGG - Intergenic
921533250 1:216311443-216311465 AATGAGAAACACCAAGTGGATGG - Intronic
923339831 1:232997827-232997849 AGTGAGAAGCAGGAGAGGGAAGG + Intronic
923410198 1:233700565-233700587 AATTAGAAACAGCAGGGACAGGG - Intergenic
923462590 1:234219992-234220014 GATCAGAAGAAGCAGGAGGAGGG + Intronic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923552972 1:234978914-234978936 AAGCAGAGGCAGCAGGGGGCAGG + Intergenic
924284862 1:242475847-242475869 CATGAGAAGAGGCACGGGGAGGG + Intronic
924422442 1:243922295-243922317 AATGAGTAGAAGAAGGGGCAAGG + Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063057044 10:2517030-2517052 AATGGAAAGAAGGAGGGGGATGG - Intergenic
1063224215 10:4000088-4000110 AAAGAGTATCAGCAGGGGCAGGG - Intergenic
1064256634 10:13747932-13747954 AATAAAAAGCAGTGGGGGGAAGG + Intronic
1065940503 10:30560098-30560120 AGTCAGAAGCAGCGGGGAGAGGG - Intergenic
1066063518 10:31745181-31745203 GAAGAGAAGGAGCAAGGGGAGGG - Intergenic
1066079175 10:31912594-31912616 AATGAGAAGTAGGAGGGCAAAGG + Intronic
1066289768 10:34003067-34003089 AATGAGAGGCCGGAGGAGGAAGG + Intergenic
1066387181 10:34951223-34951245 AATGATAATCAGCTGGGGAAGGG - Intergenic
1066557072 10:36626036-36626058 AGTGAGAAGGAGCTGGGGGTGGG + Intergenic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067394997 10:45907019-45907041 AGTGAGAAGGAGCATGGAGATGG - Intergenic
1067572131 10:47379435-47379457 AATAAGAAGGAGCAGGAGGATGG + Intronic
1067863317 10:49876150-49876172 AGTGAGAAGGAGCATGGAGATGG - Intronic
1069633398 10:69911191-69911213 ATTGAGAAGGGGCAAGGGGAAGG - Intronic
1069664347 10:70145040-70145062 GAGGAGAAGCAGCAGGGTTAGGG + Intronic
1069755675 10:70773241-70773263 GGTGAGAAGAAGCAGGGGTAGGG - Intronic
1069841299 10:71341080-71341102 AATGAGAGGCAGGAGCTGGAAGG - Intronic
1070305950 10:75239343-75239365 AATGAGTAGCAAAAAGGGGAGGG - Intergenic
1070332596 10:75429110-75429132 AAGGAGAAGGAGGAGGGGAAAGG - Intergenic
1070723886 10:78775026-78775048 TATGAGAACCAGCAGGGGTCAGG - Intergenic
1071859457 10:89657175-89657197 AACAAGCAGCACCAGGGGGATGG - Intergenic
1072105143 10:92266609-92266631 AATGGGAAGCGGGAGGGGGAAGG + Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072468965 10:95693994-95694016 AATGAGAAGAGGCACGCGGATGG - Exonic
1073091146 10:100940803-100940825 AAGGAGAAGGGGCAGGGGCAGGG - Intronic
1073275930 10:102311377-102311399 AAAGAGAAGCTGCAGGGGATGGG + Intronic
1074714265 10:116203551-116203573 AGAGAGAGGCAGCTGGGGGAAGG + Intronic
1074879841 10:117647327-117647349 ACTGAGAAGCAGCATGGACAGGG + Intergenic
1075634735 10:124022787-124022809 AATGCCAAGGAGCAGGGCGAGGG - Intronic
1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG + Intergenic
1076457127 10:130608267-130608289 TGGGAGAAGCACCAGGGGGAGGG - Intergenic
1077460065 11:2704621-2704643 GAAGAGAGGCAGCAGGGTGAGGG + Intronic
1077736970 11:4801467-4801489 AATGAGAGAGAGAAGGGGGAGGG + Intronic
1078612937 11:12837701-12837723 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1078996545 11:16706603-16706625 AATGAGAAGCAGAGAGGGGTTGG + Intronic
1079311971 11:19374899-19374921 ACTGAGAATCAGGAAGGGGATGG - Intronic
1079743058 11:24087697-24087719 AGTGAGAAGCAGCATATGGATGG + Intergenic
1079878266 11:25888509-25888531 AATGTGAAGATTCAGGGGGAAGG + Intergenic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1080438550 11:32268940-32268962 AATGGGAAGGGGAAGGGGGAGGG + Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1080867952 11:36212289-36212311 AATGAGAGACAGCACGGGAAGGG - Intronic
1081494815 11:43597929-43597951 AAAGAAAAGCAGGAGGGGGCTGG - Intronic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081575772 11:44317807-44317829 AATGAAAGGGAGGAGGGGGAAGG - Intergenic
1081646766 11:44795635-44795657 AATCAGAAGCGGCAGGAGTAAGG - Intronic
1081654889 11:44850613-44850635 AATGAGAAGATGCAAGGAGAAGG - Intronic
1081857571 11:46313236-46313258 AATCAGAAGCTCCAGGGGTAGGG + Intronic
1082072665 11:47951488-47951510 GATGAGAATAGGCAGGGGGATGG - Intergenic
1082874404 11:57973115-57973137 AATGAGATGCAGCAGCGTCAGGG - Intergenic
1084537270 11:69764548-69764570 AGTGAGAGGCTGCTGGGGGAGGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084571662 11:69963417-69963439 AAGGAGGAGGAGGAGGGGGAAGG + Intergenic
1084715939 11:70873405-70873427 AATGGGAAACAGCAGAGGGGAGG + Intronic
1085643918 11:78210338-78210360 CAGGCGGAGCAGCAGGGGGATGG - Exonic
1085867516 11:80312053-80312075 AATGAGCAGAAGCAAGAGGATGG - Intergenic
1087195642 11:95301792-95301814 AATGAGGAGCAGGGAGGGGAGGG + Intergenic
1087906508 11:103703823-103703845 AGTGAGAAGCAGCAGTGTGATGG + Intergenic
1087913622 11:103781979-103782001 AATGAGAGGAAGCTAGGGGAGGG + Intergenic
1088047613 11:105472788-105472810 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1088627564 11:111741575-111741597 AATGAGGAGCAGGAGGGAAAAGG - Intronic
1088809667 11:113382808-113382830 AACGAGAAATAGAAGGGGGAAGG + Intronic
1088886489 11:114011570-114011592 AAAGAGTAGAAGCAGGGAGAAGG - Intergenic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1088973504 11:114794307-114794329 AATATGAACAAGCAGGGGGAAGG - Intergenic
1089169081 11:116500046-116500068 AATGGACAGCAGCATGGGGAGGG + Intergenic
1089579326 11:119471518-119471540 GATCAGAGGCAGCAGGGGGCCGG + Intergenic
1089586795 11:119514738-119514760 AGTGAGCAGTAGGAGGGGGATGG - Intergenic
1089933598 11:122340130-122340152 AAAGAGAAGGAGGAGGAGGATGG + Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090933947 11:131325045-131325067 CATGAGAAACACCAGGGAGAAGG + Intergenic
1091541683 12:1468256-1468278 ACAGAAAAGCTGCAGGGGGAAGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091930147 12:4389416-4389438 AAGGAGAAGAAACAGAGGGAGGG - Intergenic
1092092369 12:5813429-5813451 AATCAGAATCTGCAGGGGCAAGG - Intronic
1093084575 12:14852460-14852482 AAGGAGGAGGAGGAGGGGGAGGG - Intronic
1093421738 12:18981887-18981909 AATGACAAACAGAAGAGGGAGGG + Intergenic
1093870185 12:24281742-24281764 AAAGTGAAGCATGAGGGGGATGG + Intergenic
1094045141 12:26158996-26159018 AATGAAAAGCAACAGGGCAAAGG - Intronic
1094250529 12:28354985-28355007 AAGGAGAGGCAGGAGGGAGAAGG - Intronic
1094337785 12:29380593-29380615 AATGAGAAGGGGGCGGGGGAGGG - Intronic
1095535311 12:43239212-43239234 CATGAGAAAGGGCAGGGGGAAGG - Intergenic
1096256114 12:50063333-50063355 GCTGAGCAGCAGCAAGGGGAGGG + Intronic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096638281 12:52975036-52975058 GAGGAGAAGGAGCAGGGAGAGGG + Intergenic
1096729982 12:53601660-53601682 AAATAGAATCAGAAGGGGGAAGG - Intronic
1096783005 12:54001566-54001588 AAGGAGAAACAGCAGGGGAGGGG + Intronic
1096863480 12:54547074-54547096 AATGAGAAGGAGCCTGGGAAAGG + Exonic
1098366818 12:69712156-69712178 AATCAGAAGCCACAGGGGGAGGG + Intergenic
1098470139 12:70833499-70833521 AATGAGAAACAGCCTGGGAATGG + Intronic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1099616432 12:84941522-84941544 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1099758869 12:86892934-86892956 AACTAGAAGCAGCAGGGGCAGGG - Intergenic
1100257545 12:92899751-92899773 AATGAGAACGAGCAAGAGGAAGG - Intronic
1100449926 12:94696063-94696085 GAGGAGCAGCAGCAGGGGGAAGG + Intergenic
1100550731 12:95644353-95644375 AAGGAGAAGAAGAAGGGGCAAGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100734077 12:97507499-97507521 AATGAGATGGAGCAGAGAGAGGG + Intergenic
1100779397 12:98008009-98008031 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1101252802 12:102951788-102951810 AATGAGAAGAAGGAGGGGGAAGG - Intronic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101746718 12:107547210-107547232 AAGGAGAAGGGGGAGGGGGAGGG + Intronic
1101803004 12:108038864-108038886 AATGAGGAGCAGCAGAGAGAAGG - Intergenic
1101883938 12:108645359-108645381 AAAGAGAAGCAGGAGGGCAAGGG - Exonic
1101957304 12:109222785-109222807 AATCAGGATCTGCAGGGGGAGGG - Exonic
1102166747 12:110813000-110813022 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1102620364 12:114189781-114189803 AATGAGAAGACACAGGGGTAGGG + Intergenic
1103192887 12:119017519-119017541 GATGGGAAGCAGCAGGAGGCTGG + Intronic
1103245536 12:119453780-119453802 AATGAGAAAGAGGAGAGGGAAGG + Intronic
1103371575 12:120423329-120423351 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1105783954 13:23729192-23729214 AATGGGGAGCAGCAGGGACAGGG + Intergenic
1105845794 13:24292539-24292561 AATGAGAAGAGGAAGAGGGAAGG + Intronic
1105881035 13:24606872-24606894 AGTGAGGAGCAGCAGGGCCAGGG + Intergenic
1106482755 13:30149107-30149129 AATGGGAAGAGGCAGGCGGATGG + Intergenic
1106550151 13:30764078-30764100 AATGAGAAGTAGAGGGGAGATGG - Exonic
1106771514 13:32965284-32965306 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1107604072 13:42040961-42040983 AAGGAGAAGCGGGAGGGGGTGGG - Intronic
1107795463 13:44046927-44046949 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1108419890 13:50237939-50237961 AATGAGATGTAGAAAGGGGATGG + Intronic
1108938906 13:55924066-55924088 AATGAGATGAAGCAAGGTGAAGG - Intergenic
1110519229 13:76455827-76455849 GAAGAGAAGCAGGAGAGGGAGGG + Intergenic
1112593451 13:100785833-100785855 AATGAAAAGAAGCGGGGGGGGGG - Intergenic
1112972123 13:105273579-105273601 AGTGAGAAGTAGCAGGGGAAAGG + Intergenic
1113421099 13:110172023-110172045 GCTGAGAAGGAGCAGGGGCACGG - Intronic
1113578305 13:111410257-111410279 AATGAGAACAAACAGGCGGAGGG + Intergenic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114522115 14:23346472-23346494 AATGCAAAGCAGCAGGGAGGAGG + Exonic
1114654865 14:24310070-24310092 GATGGGAAGGAGCAGGGTGAGGG + Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115466938 14:33725693-33725715 AATGAAAGGCAACAGGGTGAGGG - Intronic
1115529362 14:34312802-34312824 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
1115659130 14:35474595-35474617 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1116070086 14:40032653-40032675 AATCTGAAGCAACAGGGGCAAGG + Intergenic
1116090067 14:40293733-40293755 ATTGGGAATCAGAAGGGGGATGG + Intergenic
1116733243 14:48653051-48653073 AATGAGAAGAATCAGGAGTAGGG - Intergenic
1117097789 14:52315150-52315172 AATGAGAAGCAGCAGCAGGGTGG - Exonic
1117432582 14:55683326-55683348 AAAGAGATGAAGCAGGTGGAGGG - Intronic
1118491604 14:66266275-66266297 AATGAAAAGTATCAGGAGGAGGG + Intergenic
1119030248 14:71186771-71186793 AGAGAGATGCAGCATGGGGAAGG + Intergenic
1119216943 14:72876403-72876425 AAAGAGAGGCTCCAGGGGGAGGG - Intronic
1119343274 14:73899601-73899623 AATGAGAAGCAGCGTAGGGAGGG + Intronic
1119379523 14:74219604-74219626 AATGAGGAGCAGCAGAAGGTGGG - Intergenic
1119712787 14:76835006-76835028 CAAGAGAAGTAGCAGGTGGAAGG - Intronic
1120281456 14:82443669-82443691 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1120464439 14:84838764-84838786 AAAGAGAAGCAGCATGTGGTTGG + Intergenic
1121069043 14:90999498-90999520 AATGGGGAGGAGGAGGGGGAGGG + Intronic
1121734010 14:96205472-96205494 AATCAGAAGCAGGCGGGGGTGGG + Intronic
1122307743 14:100776433-100776455 AATGAGAAGCAGGAGGGAGAGGG + Intergenic
1122392786 14:101401797-101401819 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
1122413050 14:101535749-101535771 AAAGGGCAGCAGCAGGGGGTGGG - Intergenic
1122662164 14:103303720-103303742 AAGAAGAAGCAGCTAGGGGAAGG + Intergenic
1123031482 14:105453895-105453917 AATGAGCAGCTGCAGGGGTGGGG - Intronic
1123164773 14:106315675-106315697 CCTGGGAAGCAGCAGGGAGAGGG - Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124366676 15:29076857-29076879 AAAGAAAAGCAGCATGGGAAGGG - Intronic
1124943308 15:34238784-34238806 AATGTGAAGCTGAAGGGGGTAGG + Intronic
1125385629 15:39133510-39133532 AGTGAGAAGCAAGAGGGGGTTGG + Intergenic
1125537692 15:40451832-40451854 ACTGGGAAGAAGCTGGGGGAAGG + Intronic
1125546182 15:40507323-40507345 ACTGGGAAGCAGCAGGCGGGCGG - Intergenic
1125547265 15:40515243-40515265 GAGAAGTAGCAGCAGGGGGAGGG - Intergenic
1125601134 15:40916326-40916348 AAAGAGAAGGAGCAGAAGGAGGG - Intergenic
1125697496 15:41651654-41651676 AATGGGGAGGAGAAGGGGGAAGG - Intronic
1126560345 15:50036205-50036227 GATGAGAAGCAACAGAGGAAAGG + Intronic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1128061820 15:64740301-64740323 AATGAGGAGCAGCGGCGGGCGGG + Exonic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128528319 15:68427519-68427541 AGTGAGAGGCAGCAGGGAGGGGG + Intronic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1129515120 15:76152557-76152579 TATGAGAAACACCAGGGTGATGG - Intronic
1129699157 15:77757688-77757710 AAAGAGAGCCAGCAGGGGCAGGG + Intronic
1130036169 15:80363369-80363391 AGTGAGGAGCAGCAGGGCCATGG - Intronic
1130424965 15:83787820-83787842 AAGGAGAAAGAGGAGGGGGAGGG - Intronic
1130681589 15:86001641-86001663 AAAGAGAAAGAGCAGGGGGAGGG - Intergenic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131017857 15:89072512-89072534 AAGGATGAGCAGGAGGGGGAGGG + Intergenic
1131151818 15:90052038-90052060 GATGAGAAGCAGCAGAGGTGGGG - Intronic
1131284836 15:91048185-91048207 AAGAAGAAGAAGGAGGGGGAGGG - Intergenic
1131319790 15:91376351-91376373 AATGTGAAGAAGTAGGAGGAAGG + Intergenic
1131951222 15:97683707-97683729 AAAGAGAAGGGGGAGGGGGAGGG + Intergenic
1132626946 16:895709-895731 AATGAGAAACGGCAGGGGAGTGG + Intronic
1132667469 16:1088810-1088832 ACTAAGAAGCAGCAGGGGTCAGG - Intergenic
1132903409 16:2270302-2270324 ATTAAAAACCAGCAGGGGGAGGG - Intergenic
1133418273 16:5623641-5623663 CATTACAAGCAGCTGGGGGAAGG - Intergenic
1133460758 16:5984197-5984219 GAAGAGAAGAAGAAGGGGGAGGG - Intergenic
1133510720 16:6454784-6454806 AATGGGAAGAAGCAAGGGGAGGG - Intronic
1133743001 16:8665444-8665466 ATTCAGAGGCAGCAGAGGGAGGG - Intergenic
1134182306 16:12057647-12057669 AATGTGCAGCCACAGGGGGACGG + Intronic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1135294714 16:21269326-21269348 CATGAGACGCAGTGGGGGGAAGG + Intronic
1135414188 16:22256676-22256698 TCTGAGAAGCGGCAAGGGGAGGG - Intronic
1135948866 16:26893153-26893175 AATGACAAGCAGGAGGGGGCTGG - Intergenic
1136079523 16:27842587-27842609 AAGGAACAGCTGCAGGGGGAAGG + Intronic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1137667078 16:50257261-50257283 ACTCAGAAGCAGCAAGTGGAAGG + Intronic
1137833013 16:51562323-51562345 TATGGGAAGAAGGAGGGGGATGG + Intergenic
1139055099 16:63173843-63173865 AGTGAGAAGCAGGAGGAGGGAGG - Intergenic
1139270028 16:65673246-65673268 AATTAAAAGCAGCAGGGGATTGG + Intergenic
1139349033 16:66323679-66323701 AAAGAGAAGCAGGGGAGGGAGGG - Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1139640050 16:68285065-68285087 AAAAAGAAGCAGAAGTGGGAGGG - Intronic
1140209888 16:72961497-72961519 CAGGAGGAGCAGCAGGGGAATGG - Intronic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141012468 16:80415740-80415762 AATGCGAATCAGGAAGGGGAGGG - Intergenic
1141216971 16:82033760-82033782 AATGAGGGGCAGGAGGAGGAAGG - Intergenic
1141263070 16:82471327-82471349 AAGGAGAAACAGAAGGGGAAGGG - Intergenic
1141443434 16:84043593-84043615 GATTAGATGCAGCGGGGGGAGGG - Intergenic
1142492203 17:286404-286426 ACACTGAAGCAGCAGGGGGATGG - Intronic
1142601213 17:1053795-1053817 AACGGGAAGCAGGAGAGGGAGGG + Intronic
1142641550 17:1288515-1288537 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142641602 17:1288641-1288663 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142641670 17:1288786-1288808 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142643374 17:1297559-1297581 AATAACAAGCAGCAGCAGGATGG - Intronic
1143171370 17:4932508-4932530 GAAGCGAAGCTGCAGGGGGAAGG + Intronic
1143443528 17:6994165-6994187 AAACAAAAGCAGGAGGGGGAAGG + Intronic
1143613837 17:8037957-8037979 AGTGAGAAGCAGAGGTGGGAAGG - Intergenic
1143761619 17:9108367-9108389 GATGTGAAGCAGTAGGGAGAGGG - Intronic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1144300508 17:13919329-13919351 AGTGAGAAGGGGAAGGGGGAAGG - Intergenic
1145830595 17:27913210-27913232 AATGTGAGGCAGCAGTAGGAGGG - Intergenic
1146453704 17:32993815-32993837 AAGGAGGAGCAGGAGGGGAACGG + Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146615937 17:34357489-34357511 AATGTGAAGCAGCAAGTAGATGG - Exonic
1146645432 17:34573977-34573999 CAAGAGAAGCATCAGGGGCATGG + Intergenic
1147016327 17:37494618-37494640 AAAGAGAAGGAGCAGGAGGGAGG + Intronic
1147036955 17:37688821-37688843 ACTGAGGAGCAGCAGGGGCTTGG - Intronic
1147041327 17:37721588-37721610 AAAGAGAAGCAGCCGGGGTGAGG - Intronic
1147599724 17:41738424-41738446 GATGAGAAGCAGGAGAGGGAGGG - Intergenic
1147620106 17:41860703-41860725 AATGAGAAGGTGGAGTGGGATGG - Intronic
1147669120 17:42166574-42166596 AAGTAGTAGCTGCAGGGGGATGG - Intronic
1147902729 17:43799950-43799972 AAGGTGAAGCACCAGGGAGAAGG - Intergenic
1148397211 17:47318669-47318691 AATGTAAAACAGCAGGGGCAGGG + Intronic
1148638745 17:49169166-49169188 AATATGAAGCAGCATGGGAAAGG - Intronic
1148683987 17:49490521-49490543 GATGGGATGCAGCTGGGGGAGGG + Intergenic
1148806472 17:50266544-50266566 GATGAGATGGAGCAGGGGGGAGG - Intergenic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1149657729 17:58319122-58319144 ATGGAGCAGCAGCAGGGGGGTGG + Exonic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1150417824 17:65001698-65001720 ACTTGGAAGCAGCAGGTGGAGGG - Intergenic
1150457043 17:65314454-65314476 AAAGAGAAGCAGCAGACAGAGGG - Intergenic
1150793826 17:68222097-68222119 ACTTGGAAGCAGCAGGTGGAGGG + Intergenic
1151908993 17:77069061-77069083 AATGAGCAGTACCAGAGGGAAGG + Intergenic
1152175628 17:78785299-78785321 AATGAGAAGGAGCCGGCGGCAGG + Intergenic
1152397067 17:80039933-80039955 AAGGGGAAGCAGCAGTGGAAGGG + Exonic
1152474771 17:80510791-80510813 AGTGAGGAGCAGCATGGGGTTGG + Intergenic
1152601514 17:81264572-81264594 AGAGAGAAGCACCAGGGGCAGGG + Intronic
1152609187 17:81307369-81307391 AAAGGGAAGGAGGAGGGGGAGGG - Intergenic
1153406736 18:4749190-4749212 AATGAGACACAGCACAGGGAGGG - Intergenic
1154334316 18:13453769-13453791 AATGAGGGGCAACAGAGGGAAGG - Intronic
1155016800 18:21850495-21850517 AAGTAGAAGAAGCAGGGGCAAGG - Intronic
1155409880 18:25532140-25532162 AAAGAGAAGCAACAGGAAGAGGG + Intergenic
1155924920 18:31645542-31645564 AATAATAATCAGCAGGGTGATGG + Intronic
1156108514 18:33694570-33694592 ATTTAGAAGCAGTTGGGGGATGG - Intronic
1156801551 18:41120960-41120982 AATGACAAACACCAGGAGGAAGG + Intergenic
1157175364 18:45446927-45446949 GATGAGAAGCAGGGTGGGGAGGG - Intronic
1158610156 18:58932462-58932484 AAAGAGAAGCAGCAGGGGAGGGG + Intronic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159003784 18:62995164-62995186 AATGAGCGCCAGCAGGGGAAAGG - Intergenic
1159851174 18:73528706-73528728 AATGAGAAGGACCAGAGGAAAGG + Intergenic
1159869597 18:73745357-73745379 AATGACTAGCAGTTGGGGGATGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1161254463 19:3299672-3299694 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1161777082 19:6269502-6269524 AAAGAGAAGCCGCAGGCTGAGGG + Intronic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1162798465 19:13098497-13098519 AAGGAGGAGGAGCAGAGGGAGGG - Intronic
1162984119 19:14258384-14258406 CAGGAGGAGGAGCAGGGGGAAGG - Intergenic
1164684529 19:30158134-30158156 AATGGGGGGCAGCAGGGGTAAGG + Intergenic
1164696578 19:30249343-30249365 GAGGAGAAGGAGGAGGGGGAGGG + Intronic
1164868643 19:31625649-31625671 AAAGAGAAACATGAGGGGGAGGG - Intergenic
1164934677 19:32201565-32201587 AAGGAGAATCAGCAGGGTGGAGG + Intergenic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1166034961 19:40161420-40161442 GAAGAGAAGCAGAAGGGGAAGGG + Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166382485 19:42362235-42362257 GATGAGAAGCAGCAGGTGTAGGG + Intronic
1166502450 19:43352344-43352366 GAGGAGAAGCAGAAGAGGGAAGG - Intergenic
1166652133 19:44582654-44582676 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1166674947 19:44734657-44734679 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1166818857 19:45564147-45564169 AAAGAGAAGCATCAGGGTGGGGG + Intronic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1166960290 19:46492917-46492939 AAAGAGGAGGAGGAGGGGGAGGG - Exonic
1167427507 19:49437008-49437030 AATGTGAAGAAGGAGGGGGCTGG - Intronic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167702107 19:51054956-51054978 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1167775643 19:51553004-51553026 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1168251574 19:55145314-55145336 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1168338342 19:55609633-55609655 ACTGAGGAGCAGCATGGGGAAGG - Intronic
1168426764 19:56245345-56245367 AATGAGATGCGTCCGGGGGAAGG + Exonic
924982297 2:235328-235350 AATGAGAGGCAGCATGGGTCAGG + Intronic
925260556 2:2524889-2524911 AATGAGACCCAGCAGGAGCAGGG - Intergenic
925434772 2:3827294-3827316 AAGGGGAGGCAGCAGGGGCAGGG + Intronic
925657442 2:6165171-6165193 AATGAGAAACTGCAGTGGGGAGG - Intergenic
925831372 2:7899269-7899291 TATGAGTAGGAGCAGGAGGAAGG - Intergenic
926332352 2:11835993-11836015 AATGAGAATCAGGAGGGGTGTGG - Intergenic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
926811697 2:16760724-16760746 AATCAGAAGCAACATGGGCAAGG - Intergenic
927659514 2:24981045-24981067 AGAGAGAAGAAGGAGGGGGAGGG + Intergenic
927866177 2:26589153-26589175 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
928108444 2:28488178-28488200 AAGGAGGAGAAGGAGGGGGAGGG + Intronic
929347230 2:40899666-40899688 AAGGAGAAGCATCAGGGGTAAGG - Intergenic
930741254 2:54835035-54835057 AGGGAGAAGCAGCGAGGGGAAGG - Intronic
930838999 2:55825434-55825456 AGTGAGGAGTAGCAGGGGCAGGG - Intergenic
931183475 2:59927054-59927076 AGTGAGAAGCAGGAGGGGGTAGG + Intergenic
931826301 2:66004196-66004218 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
931967677 2:67551338-67551360 AAGGAGAAGCAACAAGGAGAAGG + Intergenic
932283284 2:70512923-70512945 AATCAGGAGGAGCAGGAGGAAGG + Intronic
932429568 2:71666038-71666060 AATGAGAAGGAGGAGGGGGTGGG - Intronic
933080395 2:77977658-77977680 ACTTAGAGGCAGCAGGGGAAGGG - Intergenic
933272230 2:80245579-80245601 AATGACAAGCAGGAATGGGATGG - Intronic
933574785 2:84055142-84055164 AGTGAGGAGCAGCAGGGTCAGGG - Intergenic
933918152 2:87017607-87017629 ACTAAGAAGCAGCTGGGGGCAGG - Exonic
934004842 2:87752306-87752328 ACTAAGAAGCAGCTGGGGGCAGG + Exonic
934084905 2:88501953-88501975 TATGAGGAGGAGCAGGGGTAGGG - Intergenic
934653104 2:96103550-96103572 TATGAGGAGCAGCAGCAGGAGGG - Intergenic
935767799 2:106386339-106386361 ACTAAGAAGCAGCTGGGGGCAGG + Intergenic
936108340 2:109644810-109644832 ATTGACAAGCAGCCGGGGGGAGG - Intergenic
936154106 2:110037169-110037191 AAGGGGAAGAAGCAGAGGGAGGG - Intergenic
936190578 2:110334246-110334268 AAGGGGAAGAAGCAGAGGGAGGG + Intergenic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
937004678 2:118500810-118500832 AATAGGAAGGAGCAGGAGGAGGG + Intergenic
937130905 2:119512334-119512356 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
937646320 2:124269549-124269571 CATGATAAGCACCAGGGAGAGGG + Intronic
938314730 2:130317750-130317772 ACTGAGAGGGTGCAGGGGGAGGG - Intergenic
938508846 2:131918302-131918324 CATGAGAAGCATCACGTGGATGG - Intergenic
939069454 2:137521492-137521514 AATGAGAAGAAAAAGAGGGATGG - Intronic
939863883 2:147450931-147450953 AATGCGGAGAAGCTGGGGGAGGG + Intergenic
940581335 2:155584452-155584474 AGTGAGGAGTAGCAGGGGCAGGG - Intergenic
941712665 2:168730474-168730496 AATGAGAAATAGCAGGGGGTGGG + Intronic
941712752 2:168731615-168731637 AAGGAGAAGTAGCAGGGGGTGGG + Intronic
944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG + Intergenic
945837472 2:214849841-214849863 AATGGGATGCAACAGGGAGAGGG + Intergenic
946993640 2:225365159-225365181 GAGGAGAAGCAGCAGGGGTGAGG - Intergenic
947217146 2:227759814-227759836 AAAGAGAAGCAGCGGAGGGGTGG - Intergenic
947445095 2:230157167-230157189 AAGAGAAAGCAGCAGGGGGAAGG - Intergenic
948058239 2:235025413-235025435 AATGATAAGCAGCCGAGGGAAGG + Intronic
948332856 2:237183851-237183873 ACTGAGAAGTGGCTGGGGGATGG - Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948539004 2:238672376-238672398 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558594 2:238835350-238835372 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948735729 2:240003769-240003791 GATGAGAAGCAGCAGGGGGTGGG + Intronic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1168905898 20:1403533-1403555 GATGGGCAGCAGGAGGGGGAGGG + Intergenic
1169341225 20:4797896-4797918 AATAAGAAGCAGGAGAGGCAGGG + Intronic
1169687874 20:8296588-8296610 AAAAAGAAGGAGCAGAGGGATGG + Intronic
1169765574 20:9144661-9144683 AAGGAGGAGGAGGAGGGGGAAGG + Intronic
1169791650 20:9416149-9416171 AATGAGAAATGGCAGGGGAAAGG - Intronic
1170210377 20:13841356-13841378 AATGAGAAGCCCCGAGGGGATGG - Intergenic
1170579238 20:17685244-17685266 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1171820265 20:29829893-29829915 AAGGAGACTCAGCAGGGTGAGGG + Intergenic
1172424669 20:34847277-34847299 TATGAGAAGCAGCTGGGATATGG - Intronic
1172460504 20:35114767-35114789 AGTAAGAAGCAGCCGGGGCATGG + Intergenic
1172471104 20:35196921-35196943 AATTATAAACAACAGGGGGAAGG + Intergenic
1172895235 20:38295553-38295575 GATGTGAAGCAGAGGGGGGATGG + Intronic
1172939322 20:38643836-38643858 AAGGAGAAGCAGCTGGCAGAAGG + Exonic
1172949824 20:38715779-38715801 GGTGAGATGCAGGAGGGGGAGGG - Intergenic
1173336135 20:42113685-42113707 AGTGGGAAGCAGGAGAGGGAAGG - Intronic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173756782 20:45523406-45523428 AATGTGAAGGACCAAGGGGAGGG - Intergenic
1173775128 20:45698985-45699007 AAGGAGGAGAAGGAGGGGGAGGG + Intronic
1174119049 20:48248598-48248620 ATTGAGAAGCAGGAGAGGGGTGG - Intergenic
1174150375 20:48482158-48482180 GAGGAGGAGGAGCAGGGGGAAGG + Intergenic
1174417376 20:50376551-50376573 AAGGCGAAGCAGCTGGGAGAGGG + Intergenic
1174449939 20:50613565-50613587 AATGAGAACCAGCAGTGTCATGG + Intronic
1174720263 20:52804040-52804062 AATGAGAAGCAGCAGCCGGCTGG + Intergenic
1175600296 20:60267348-60267370 AGTGAGATGGAGCAGGGGAAAGG + Intergenic
1175935599 20:62512549-62512571 ATTAAGGAGCAGCAGGGGGTGGG - Intergenic
1176784646 21:13240246-13240268 CATGAGAAGCATCACGTGGATGG + Intergenic
1177149348 21:17438962-17438984 AATGAAATGCAGCTGGAGGATGG - Exonic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177507230 21:22034750-22034772 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1177610518 21:23441857-23441879 AGTGGGAAGTAGCAGAGGGAAGG - Intergenic
1177610579 21:23442496-23442518 AATGGGAAGTAGCAGAGGGAAGG + Intergenic
1177854562 21:26386598-26386620 ACTGAGAAGTAGTAGGGGAAAGG - Intergenic
1177982694 21:27934091-27934113 CATGAGAAGCATCACGTGGACGG + Intergenic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1178685347 21:34706319-34706341 AAAGGGCAGCAGCAAGGGGATGG + Intronic
1178691869 21:34756477-34756499 TATGGGAAGCAGCAGGATGAAGG - Intergenic
1178809401 21:35867620-35867642 ATTGAGAAGAAGCAGGGAGGTGG + Intronic
1181947645 22:26530645-26530667 AATCAGCAGGAGCAGGTGGAAGG + Intronic
1182059818 22:27388769-27388791 AATCAGAAGCATCAGTGGAATGG + Intergenic
1182122098 22:27794890-27794912 GATGAGAAGGGGAAGGGGGAGGG + Intronic
1182550033 22:31095943-31095965 AGAGAGGAGCAGCAGGGAGAAGG - Intronic
1182886410 22:33777672-33777694 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183339871 22:37274199-37274221 AAGGGGGAGCAGCAGAGGGATGG - Intergenic
1183480587 22:38062601-38062623 AAAGAGAAGGGGCAGGGGCAGGG - Intronic
1183616749 22:38950390-38950412 GATTAGAAGCAGCAGTGAGAGGG + Intergenic
1183697158 22:39429967-39429989 AATCAGAAGCAGCCGGGTCAAGG - Intronic
1183864027 22:40690179-40690201 GAAGAGAGGCAGCCGGGGGATGG - Intergenic
1184424131 22:44399168-44399190 AATGGGAAGGAGCAGGGTGGGGG + Intergenic
1184449686 22:44575634-44575656 GATGACAAGGAGAAGGGGGATGG + Intergenic
1185009433 22:48304996-48305018 ACGGAGATGCAGCAGGGGGTGGG + Intergenic
1185263529 22:49884944-49884966 CCTGAGAAGCAGCAGGCTGATGG + Exonic
1185292290 22:50033107-50033129 AGTGAGAAGCAGCACGGGCAGGG - Intronic
949213761 3:1538841-1538863 ACTGAGACCCAGCAGGGTGAAGG - Intergenic
949366267 3:3284995-3285017 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
949616802 3:5762531-5762553 AATGAGCGGCAGCAGTGGGATGG + Intergenic
950542699 3:13621674-13621696 AATGAGACCCAGCAAGGGGCAGG - Intronic
950651070 3:14406997-14407019 AATCAGAACCTCCAGGGGGATGG + Intronic
950672640 3:14536444-14536466 AATGAGAAGCATCAGGGCACTGG + Intronic
950847591 3:16030010-16030032 CATGAGAAGCTGCATGGGCAGGG + Intergenic
951269035 3:20602914-20602936 AATGAGGAGTAGCAGAGGCAAGG + Intergenic
951336453 3:21428567-21428589 TATGAGAAAAAGCAGGGGGTGGG - Intronic
951795925 3:26538228-26538250 AAAGGGAAGGAGAAGGGGGAGGG + Intergenic
952723215 3:36555067-36555089 AATCACAGGCAGCTGGGGGATGG + Intergenic
952882431 3:37993134-37993156 AATGAGAAGTACCTGGGGGAAGG - Intronic
953818943 3:46187741-46187763 AATGGGAAGCAGCAGAGGCCTGG + Intronic
954212066 3:49103545-49103567 AGTGAGAAGGAGGTGGGGGAAGG - Intronic
954501957 3:51025785-51025807 AAGTAGAAGCAACAGTGGGAAGG - Intronic
954649660 3:52153485-52153507 AGGGAGGAGCAGCTGGGGGAGGG + Intronic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
954706417 3:52483167-52483189 GAAGCGAAGCAGCAGGGGGTAGG - Intronic
954783862 3:53079240-53079262 AATGAGAAGGAGGAAGAGGAAGG + Intronic
954857694 3:53660699-53660721 AATGGGGAGCATCAGAGGGATGG + Intronic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
956197097 3:66663839-66663861 AATGAGCAGCAGCATTTGGAAGG - Intergenic
956310835 3:67877814-67877836 AAAGAGAAGGAGGAGAGGGAGGG - Intergenic
956621608 3:71226596-71226618 AATGAGATGCAGAAGGGGGTAGG - Intronic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
957593119 3:82225707-82225729 AGTGAGGAGTAGCAGGGGCAGGG + Intergenic
957938010 3:86968911-86968933 ACTCAGACACAGCAGGGGGAGGG + Exonic
958566282 3:95815542-95815564 ACTGAGAGGCAGGAGAGGGAGGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
959963814 3:112332219-112332241 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
960121083 3:113948650-113948672 AATGAGAAGAGAGAGGGGGAGGG - Intronic
960420315 3:117437273-117437295 AAGAAAAAGCAGCAGGGGAAGGG + Intergenic
960758766 3:121049390-121049412 AGTGAGAAGTAGCAGGGGTGGGG + Intronic
960845557 3:122001399-122001421 AATCAGCAGCAGGAGGAGGAGGG + Exonic
960912772 3:122665938-122665960 AAAGAGAAGCAGTAGGGGCCTGG + Intergenic
961513211 3:127416499-127416521 AATGAGAAGGGGGAGGAGGAGGG + Intergenic
961535953 3:127570673-127570695 CATGTGCAGCAGCAGTGGGAAGG + Intergenic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
962963447 3:140332322-140332344 AAAGAGATGAAGCTGGGGGAGGG + Intronic
962966877 3:140363885-140363907 AATGAGGAGCAGTAGGAGGCAGG + Intronic
963017462 3:140839602-140839624 ATTCAGAAGAAGCAGGGGAAAGG - Intergenic
963049805 3:141131257-141131279 AATGGGAAAAAGTAGGGGGAAGG - Intronic
963366185 3:144337473-144337495 CATGAGAGGAAGGAGGGGGAAGG - Intergenic
965090442 3:164155599-164155621 AAGCAGAAGCAGCAGGGTAAGGG + Intergenic
965301853 3:167014855-167014877 AAAGATAAGCAGCAGGGACAGGG + Intergenic
965848345 3:172990963-172990985 AGTGAGCAGCAGCAGGAGAAGGG + Intronic
966095757 3:176200804-176200826 AATGAGGGGCAGCAGGTGGCAGG + Intergenic
966095806 3:176201605-176201627 AATGAGGGGCAGCAGGTGGCAGG - Intergenic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966559173 3:181300003-181300025 AATGAGAAGGAGGAGGAGAAGGG + Intergenic
967833778 3:193943880-193943902 AATGAGCAGCTGTATGGGGATGG + Intergenic
969135745 4:5027351-5027373 AATGAGAAACAGCAGGCAGGAGG + Intergenic
969695191 4:8730257-8730279 CATGAGAAGGAGCAGGGGTGGGG + Intergenic
969723094 4:8904143-8904165 GAGGAGAAGCAGCAGGTCGAGGG - Intergenic
969928080 4:10603951-10603973 AATGAGAAGGAGCAGAAAGAAGG + Intronic
969980907 4:11153169-11153191 CATATGATGCAGCAGGGGGAAGG + Intergenic
970600491 4:17637816-17637838 GCTGAGAAGAAACAGGGGGAGGG - Intronic
971105215 4:23517342-23517364 AAGGAGAAGGAGGAGTGGGAAGG - Intergenic
971265632 4:25094130-25094152 GATGAGAAGCAGAGGAGGGAAGG - Intergenic
971305117 4:25473295-25473317 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
971556302 4:28016396-28016418 AGTGAAAAGCAGCAGGTGAAAGG + Intergenic
971819282 4:31530623-31530645 AGTGAGAAGTAGCAGGGGCAGGG + Intergenic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974753773 4:66176784-66176806 AATGAGAAGGAGAAGGAGAAGGG + Intergenic
975822204 4:78283036-78283058 AATGAAAAGAAGCAAGGGGGTGG - Intronic
975969403 4:80015712-80015734 GAAGAGAAGAAGCAGGAGGAGGG + Intronic
976022540 4:80646750-80646772 AAAGAGAAGCAACAGGAGAAGGG - Intronic
976633843 4:87267529-87267551 AATAAGAAGGAGAAGGGAGATGG - Intergenic
977984292 4:103363571-103363593 GGTAAGAAGTAGCAGGGGGAAGG - Intergenic
979071692 4:116215759-116215781 AATGAGAAGCAGCTGCAGTAGGG + Intergenic
979193886 4:117897024-117897046 AATGAGAAGAAACAGGGTGGAGG - Intergenic
980879938 4:138699746-138699768 AACGAGAAGGAGCAGTGAGAAGG + Intergenic
980978122 4:139630668-139630690 AATGAGATGCCACAGGGGCAGGG + Intergenic
982088185 4:151857613-151857635 AATGAGATGGAGGAGGGAGATGG - Intergenic
982227002 4:153175473-153175495 ATTGGGAAACAGCGGGGGGAGGG + Intronic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
983345137 4:166519898-166519920 AGTGAAAAGCATCAGTGGGAAGG + Intergenic
984244799 4:177262182-177262204 AATGATAAACATCAGAGGGATGG + Intergenic
984551858 4:181170407-181170429 AATAGGAAGCAGCATGTGGAAGG + Intergenic
984836726 4:184029171-184029193 AAAGAGAAGGAGCAGGAGGTGGG - Intergenic
984951644 4:185012267-185012289 AAAGAAAAGCAGCAAGTGGAGGG - Intergenic
985094176 4:186396315-186396337 AATCAGAAACTGCAGGGGTAGGG - Intergenic
985140940 4:186840379-186840401 AAGGAGGAGAAGGAGGGGGAGGG - Intergenic
985493057 5:190312-190334 AAAGAGAAACAGCAGTGGGAGGG - Intergenic
985690136 5:1304316-1304338 AAGGAGAAGGAGAAGGGAGAAGG - Intergenic
986156049 5:5177019-5177041 AAGGAGAAGCAGGACTGGGAAGG - Intronic
986221730 5:5774769-5774791 GAGGAGAAGGAGGAGGGGGAGGG - Intergenic
986247449 5:6023242-6023264 ATGGAGAAGCAGCAGGGAAAAGG + Intergenic
987926530 5:24349703-24349725 AATTAGGAGAAGCAGGGTGAGGG - Intergenic
988104118 5:26721281-26721303 AATGAATAGAAGCAGGGGCAAGG - Intergenic
989490342 5:42044904-42044926 ATTGAAAAGCAGTAGGGAGAGGG - Intergenic
990007257 5:50958110-50958132 ACTCAGCAGCAGCAGCGGGAAGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990719617 5:58679174-58679196 AAGGAGAAGCAGCAGGGTGGGGG + Intronic
990916429 5:60911201-60911223 AATGTGGAGAAGTAGGGGGAGGG - Intronic
991185097 5:63797077-63797099 AATGAGGAGGAGGAGGAGGATGG + Intergenic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
992018015 5:72595269-72595291 AAAGAGCAGCATCAGGGGAAAGG + Intergenic
992744741 5:79807975-79807997 GATCAAAAGCAGGAGGGGGAGGG - Intergenic
993061202 5:83041217-83041239 AATGAGAAACAACATGTGGATGG - Intergenic
993424206 5:87742074-87742096 AAAGTGAAGTAGCAGTGGGAGGG - Intergenic
993698656 5:91092658-91092680 GATGAGAAGCAGCAAGGTAATGG + Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994302719 5:98165073-98165095 AAGCAGAAGCAGAAGGGGAAGGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
995042602 5:107605853-107605875 ACTGGGAGGAAGCAGGGGGAGGG + Intronic
995173036 5:109139453-109139475 AAGGAGAAGTAGCAGGAGAATGG - Intronic
995483251 5:112613977-112613999 AGTGAAAAGCAGAAGGGGAATGG + Intergenic
995667477 5:114559386-114559408 AATGAGAAGGGGCATGAGGAGGG + Intergenic
995752613 5:115470121-115470143 AGTAAGAAGAGGCAGGGGGAGGG - Intergenic
997434136 5:133862030-133862052 ACTGAGAAGCAGGAGGGGCCAGG + Intergenic
997750137 5:136336474-136336496 AATGAGAAGCAGAAAGGGCTAGG + Intronic
998549864 5:143067035-143067057 AAGCAGAAGCGGGAGGGGGAGGG - Intronic
998874337 5:146584095-146584117 AATGAGCAGCAGGGGCGGGAAGG + Intronic
999039963 5:148398028-148398050 AATGAGATGCACCAGCTGGAGGG - Intronic
999057749 5:148598167-148598189 AATGAGGAGGAGCTGAGGGAAGG + Intronic
999125001 5:149240089-149240111 ACTGAGAAGCAGCAGGAAGGTGG + Intronic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000850429 5:166333294-166333316 AAAGAGAAGCAGCAGGAGCCAGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1001663400 5:173413196-173413218 AATGGGAAGCAGCACAGGGCAGG + Intergenic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1001887227 5:175303958-175303980 AATGAGTAGCGGAAGGAGGAAGG - Intergenic
1002173679 5:177389372-177389394 CACAAGAAGCAGCAAGGGGAAGG - Intronic
1002971101 6:2021035-2021057 CAGGAGAAGCAGCTGGGAGAAGG - Intronic
1003272915 6:4623230-4623252 AAGGGGAAGCGGCAGGGGGGCGG + Intergenic
1003315853 6:5011350-5011372 AAAGAGACACAGCAGGAGGAAGG + Intergenic
1003994333 6:11523579-11523601 AAGGAGGAGCAGCAAGGCGATGG + Intergenic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004573825 6:16873544-16873566 AGTGAGAAACAGGAGGAGGATGG + Intergenic
1005819688 6:29587766-29587788 AATGAGAAGGAGCTGCTGGATGG + Exonic
1005857029 6:29870435-29870457 ATTGAGAAGCAGGAGGGTGAAGG + Intergenic
1005862848 6:29914586-29914608 ATTGAGAAGCAGGAGGGTGAAGG + Intergenic
1005874351 6:29999784-29999806 ATTGAGGAGCAGGAGGGTGAAGG + Intergenic
1005885915 6:30097590-30097612 AATGGGAAGCAGGTGGGGGCAGG + Intergenic
1007071868 6:39043828-39043850 GAAGAGAAGCAGGAGGTGGAGGG + Intergenic
1007193444 6:40039237-40039259 TATGACAGGAAGCAGGGGGATGG + Intergenic
1007410514 6:41658684-41658706 AAGGTGAAGCAGCAGGCTGAAGG + Intergenic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1007630227 6:43269421-43269443 AGAGAGAAGGAGGAGGGGGAAGG + Intronic
1007661645 6:43490393-43490415 CATGAGAAGCAGCAGCAGCATGG - Intronic
1007829056 6:44624490-44624512 AATGAGAACCTGAAGGAGGAGGG + Intergenic
1008420551 6:51294224-51294246 AGTGAAAATCAGCAGGTGGATGG - Intergenic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1009031015 6:58058119-58058141 AAAGAGAAGGAGGTGGGGGAAGG + Intergenic
1009051891 6:58285443-58285465 AAAGAGAAGAAGCAAGAGGAAGG - Intergenic
1009380494 6:63023007-63023029 AATGAGAAGTAGATGGGAGAAGG - Intergenic
1009442006 6:63691493-63691515 AATGAGAAAATGCTGGGGGAGGG - Intronic
1009672474 6:66773728-66773750 GATGACAAGCAGAATGGGGAAGG - Intergenic
1010398366 6:75418993-75419015 AATGGGAGGCTGCAGGGGGTGGG - Intronic
1011059062 6:83242450-83242472 AACTAGAAGTAGCAGGGGGATGG + Intronic
1011629526 6:89310727-89310749 GATGAGAAGCGGGAGGGGGTGGG + Intronic
1011650277 6:89499789-89499811 ACTGAGGAGCAGCAGGGAAAGGG - Intronic
1011677791 6:89752239-89752261 GTTGAGAAGCAATAGGGGGAGGG + Intronic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012611150 6:101222624-101222646 GAAGGGAAGCAGGAGGGGGAGGG - Intergenic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1013348133 6:109282072-109282094 AAAGAGGAGAAGCAGGGAGAAGG - Intergenic
1013705562 6:112829862-112829884 ACTGACAAGCAGCAGTGGAAAGG - Intergenic
1014103118 6:117533507-117533529 AATAAAAAGTAGGAGGGGGAAGG - Intronic
1014294200 6:119598407-119598429 AAGGAGAAGGAGAAGGGGAATGG + Intergenic
1015018160 6:128439196-128439218 TATGTGAAGCAGGAAGGGGAAGG - Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015505926 6:133988167-133988189 AATAAGATACAGCAAGGGGAAGG - Exonic
1016833689 6:148456218-148456240 AAAGTGAGGCAGCAGGGGGCTGG - Intronic
1017339568 6:153305201-153305223 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017339582 6:153305249-153305271 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1018429696 6:163713406-163713428 AATGGGAAGGAGTGGGGGGAGGG - Intergenic
1019638301 7:2088626-2088648 AGCGAGAGGCAGCAAGGGGACGG + Intronic
1020861460 7:13496940-13496962 AATGAGCAGCAGCAGCAGAAAGG + Intergenic
1021352053 7:19605874-19605896 AATGAAAAGAAGGAGGGGAAAGG - Intergenic
1021697159 7:23286448-23286470 AATGAGCAGGAGACGGGGGAGGG - Intergenic
1022027313 7:26460581-26460603 AAGGAGAAGCAAGAGAGGGAAGG + Intergenic
1022074911 7:26958486-26958508 AATGAGAATATGCAGGGGAATGG - Intronic
1022230396 7:28408397-28408419 AAGGAAATTCAGCAGGGGGATGG + Intronic
1022274416 7:28841799-28841821 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1022703009 7:32778868-32778890 AATGAGAGGCAGCAAGGGGCAGG - Intergenic
1022850562 7:34257324-34257346 AAAGAGAAGCCACAGGGGGTGGG - Intergenic
1023085713 7:36568334-36568356 ATTGAGAACCAGCAGAGGCAAGG - Intronic
1024509338 7:50190817-50190839 AATGAGCAGCAGCAGGGTACTGG + Intergenic
1024581952 7:50807627-50807649 AATAAGATGCAGCAGGAGCACGG - Intergenic
1025253262 7:57365983-57366005 AAGGCGAAGCAGCTGGGAGAGGG - Intergenic
1026285045 7:68955407-68955429 AAGGGGAAGAGGCAGGGGGATGG + Intergenic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1027176428 7:75906700-75906722 AATGAGAAACAGGAGGGAGGCGG - Intronic
1027332029 7:77107248-77107270 AATGAGAAGGAGAAGGGGAAGGG - Intergenic
1027532344 7:79352527-79352549 AAGCAGAAGCATGAGGGGGAAGG + Intronic
1028070828 7:86448038-86448060 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1028528186 7:91808724-91808746 AATGAGAGGTAGTGGGGGGAGGG + Intronic
1029783746 7:102764077-102764099 AATGAGAAGGAGAAGGGGAAGGG + Intronic
1030007776 7:105135434-105135456 AGAGAGCAGCAGCAGAGGGAAGG + Intronic
1030638236 7:111974414-111974436 ATTGAGGAGAAGCAGTGGGAAGG + Intronic
1031374510 7:121007786-121007808 AAAGAGAAGCAGCAACAGGATGG - Intronic
1032070131 7:128799701-128799723 AATGAGCAGAAGTTGGGGGAAGG + Intronic
1032397667 7:131602309-131602331 AATGAGAAGCTGCAGGTACAAGG - Intergenic
1032477585 7:132222937-132222959 AATGAGAAGCTCCGGGGGCAGGG - Intronic
1032746946 7:134795606-134795628 AAAGAAAAGGAGGAGGGGGAAGG - Intronic
1032767836 7:135016581-135016603 AAGGAGAAGTGGCAGGGGTAGGG + Intronic
1032839767 7:135704479-135704501 AGTCAGAAGCAGCAGAGTGAGGG + Intronic
1032948716 7:136882440-136882462 GCTGAGAAGAAGGAGGGGGAAGG - Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033807872 7:144975313-144975335 CATGAGAAGCAGGATGGGGTGGG + Intergenic
1033889594 7:145994978-145995000 AAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1034319708 7:150168839-150168861 AAAGAAAATCAGCTGGGGGATGG + Intergenic
1034354418 7:150441860-150441882 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1034978920 7:155463489-155463511 AAAGAGAAGGAGGAGGAGGAAGG - Exonic
1034993872 7:155566037-155566059 ACTGAGAGACAGCAGGGAGACGG + Intergenic
1035147080 7:156829672-156829694 AATGAGGAGCAGCAGGGCCATGG - Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035724209 8:1814420-1814442 AAAGAGAAGCAGCAGAGAGGAGG - Intergenic
1035760446 8:2064777-2064799 GAGGAGAAGGAGGAGGGGGATGG - Intronic
1036106762 8:5849110-5849132 AATGAGAAGCATCATGGTGTGGG - Intergenic
1036295213 8:7529236-7529258 AAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1036327357 8:7791782-7791804 AAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1036557136 8:9870094-9870116 AAAGTGAAGCACCAGGGGGCCGG + Intergenic
1037787279 8:21910591-21910613 GGTGAGAAGCAGCGAGGGGATGG - Intronic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037864147 8:22429613-22429635 AATTGGGAGCAGCATGGGGATGG + Intronic
1038353059 8:26798483-26798505 AATGAGAATAAGCAGGAGGTAGG - Intronic
1038885520 8:31658780-31658802 AATGTTAATCAGCAGAGGGAAGG + Intronic
1039126755 8:34211942-34211964 AATGATAAACTGCAAGGGGAAGG - Intergenic
1040075240 8:43222775-43222797 AATGAGAAGCAGTTAGGGGCTGG + Intergenic
1040079746 8:43274824-43274846 AATGAGAATGAGGAGGAGGAGGG - Intergenic
1040571506 8:48615556-48615578 AATGAGAAGCAGAACTGTGAGGG - Intergenic
1040944449 8:52869046-52869068 CATGAGAGGCAGCTGGGAGAGGG - Intergenic
1041003973 8:53481508-53481530 AAGGATGAGCAGCATGGGGATGG - Intergenic
1041067045 8:54092093-54092115 AAGGAGAAGGAAGAGGGGGAGGG + Intronic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1041952543 8:63520079-63520101 AATAAGAAGAAGCAGAAGGATGG + Intergenic
1042161958 8:65905460-65905482 CATGAGATTCAGCAGGGGGCAGG + Intergenic
1042573299 8:70190901-70190923 AATGAGAAAAATCAGGGGAATGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043305175 8:78784865-78784887 AAGGAGAAGATGGAGGGGGAGGG - Intronic
1043811348 8:84745180-84745202 AATGTGAAGGAGTAGAGGGAGGG - Intronic
1044096668 8:88074704-88074726 AGTGAGAAACAACAGGGTGATGG - Exonic
1044138297 8:88615070-88615092 AATGAGAAGAATCAGGTGGTGGG + Intergenic
1044422933 8:92019406-92019428 AAGGAAGAGCAGGAGGGGGAGGG + Intronic
1044731943 8:95235955-95235977 AATGATGAGCAACAGGGGGATGG + Intergenic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1045009916 8:97950006-97950028 AGTGGGGAGCAGCAGGGAGAGGG + Intronic
1045186265 8:99841657-99841679 ACTGAGAAGCAGTAGGCAGAAGG - Intronic
1046015602 8:108601132-108601154 AAGGAGAAGGAGGAGGGAGAGGG + Intergenic
1046061441 8:109144664-109144686 AAAGGGAAGGAGCAGGGGGTGGG - Intergenic
1046285894 8:112092485-112092507 AGTGAGGAGCAGCAGGGGCAGGG + Intergenic
1047722827 8:127657664-127657686 GATGAGACCCAGCAGAGGGAAGG + Intergenic
1047939612 8:129816367-129816389 AATGAGGAGCAGCAGTGGTGAGG + Intergenic
1047994336 8:130319252-130319274 AATTAGTAGCAGCTGGGGGCTGG - Intronic
1048276118 8:133067299-133067321 AAGGAGAAGCAGATGGGGGTGGG - Intronic
1048572484 8:135667295-135667317 ACTGAGCACCAGCAGGAGGAGGG - Intergenic
1048572942 8:135669952-135669974 AATGTGAGGCAGAAGAGGGAGGG - Intergenic
1048696272 8:137031659-137031681 AATTAGGAGGAGAAGGGGGAGGG - Intergenic
1048767402 8:137859932-137859954 AAGGAGGAGGAGCAGGAGGAGGG + Intergenic
1048964159 8:139603290-139603312 AATGACCAGCAGCAGGGGTGTGG + Intronic
1049287479 8:141783660-141783682 AATGGGAAACAGCAGGAGAAGGG + Intergenic
1049334604 8:142076527-142076549 CATGAGAAGGAGCCGGGGGCAGG - Intergenic
1049594847 8:143478491-143478513 AATAAGAAGGAGCGGGGGCATGG - Intronic
1050575831 9:6994311-6994333 GAAGAAAAGCAGCAGGGGGAGGG - Intronic
1051146198 9:14030192-14030214 GATGAGCAGCAGCGGGGGGGGGG + Intergenic
1051146578 9:14033430-14033452 ACTGAGAAGTAGCTGGGAGAAGG + Intergenic
1051200884 9:14622472-14622494 AATGAGAGGTTGCAGGGGGGTGG + Intronic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1052343581 9:27386054-27386076 AAGGAAAAGCAGCAGCAGGATGG - Intronic
1052871753 9:33514401-33514423 AATGAGAAGCAGTTAGGGGCTGG + Intergenic
1052968769 9:34363625-34363647 AGAGAGCAGCAGCAGGGGGAAGG - Intergenic
1053415533 9:37944834-37944856 CAGGAGAAGCTGCAGGGAGAAGG - Intronic
1054856790 9:69909068-69909090 AATGTGAAATAGTAGGGGGAAGG + Intergenic
1055074237 9:72197286-72197308 ATAGAGAGGCAGCAGGGAGAGGG - Intronic
1055688898 9:78808774-78808796 AAGGAAAAGCAGCAGAGAGAGGG - Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056546840 9:87620548-87620570 GAAGAGAAGGAGTAGGGGGAGGG + Intronic
1056662107 9:88551649-88551671 AGAGAGAAGCAACAGGGGAAGGG - Intronic
1057339814 9:94190056-94190078 AATGAGAAGCAGGAGGGGAGTGG - Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057396046 9:94681449-94681471 GATGAGAAGGAGGAGGAGGATGG - Intergenic
1057685852 9:97233553-97233575 AATGAGAAGCAGTTAGGGGCTGG - Intergenic
1057824925 9:98365030-98365052 AATGGGCAGGGGCAGGGGGAGGG + Intronic
1058888166 9:109338746-109338768 AATGAGAGTGAGCAGGGGGAGGG - Intergenic
1058905260 9:109477654-109477676 AATTATTAGCAGCAGCGGGAGGG + Intronic
1058939738 9:109801909-109801931 AATGAGAGGGACCATGGGGAGGG + Intronic
1059691240 9:116687591-116687613 GAGGAGATGCAGCTGGGGGAGGG + Intronic
1060268610 9:122126428-122126450 AATGTGAAGCTGGAGGGGGAGGG + Intergenic
1060702118 9:125764172-125764194 ACTGAGAAAAACCAGGGGGAGGG - Intronic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1061221945 9:129257291-129257313 AATAAAAAGGAGCTGGGGGAGGG - Intergenic
1061743299 9:132722752-132722774 AGTCCGAAGCAGCAGGGGGTTGG + Intergenic
1061899691 9:133666542-133666564 AAGGAGGAGAAGGAGGGGGAAGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062469704 9:136697007-136697029 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1062564522 9:137158256-137158278 CAGGAGAAGGAGCAGGGAGAAGG + Intronic
1062564527 9:137158269-137158291 AGGGAGAAGGAGCAGGGGGAAGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062638360 9:137503426-137503448 AAGGAGAATGAGGAGGGGGAAGG + Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638398 9:137503540-137503562 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638407 9:137503575-137503597 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1203563696 Un_KI270744v1:76690-76712 ACTGAGAGGGTGCAGGGGGATGG - Intergenic
1185575491 X:1169031-1169053 AAAGAGAAGGAGGAGGTGGAGGG + Intergenic
1185662053 X:1735650-1735672 AAAGAGGAGGAGGAGGGGGAGGG - Intergenic
1186318525 X:8397999-8398021 AATGAAAAGTAGGAGGGGGGAGG - Intergenic
1186410597 X:9342275-9342297 GGTGGGAAGGAGCAGGGGGAGGG - Intergenic
1186429533 X:9493068-9493090 ACTGATAAGAAGCAGGTGGAGGG - Intronic
1186471165 X:9823094-9823116 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471172 X:9823126-9823148 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186532850 X:10314687-10314709 AATGAGAGGCAGGAGAGGGAAGG + Intergenic
1186734008 X:12441549-12441571 AATGATAGGCAGCTGGGGCAGGG + Intronic
1187025821 X:15434334-15434356 AACGAGAAAAAGGAGGGGGAAGG + Intronic
1187843793 X:23515444-23515466 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1188724276 X:33562286-33562308 GAAGAGGAGCAGGAGGGGGAGGG - Intergenic
1189066245 X:37812362-37812384 AAGGAGAAAGAGCTGGGGGAAGG + Exonic
1189244736 X:39554728-39554750 TTTGAGGAGCAGCAGGGGAAAGG - Intergenic
1189267440 X:39727918-39727940 AAGGAGAAGGTGCTGGGGGATGG - Intergenic
1189684398 X:43548814-43548836 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1190171006 X:48111633-48111655 ATGGAGAAGGAGCAGGGGCAGGG + Intergenic
1191055138 X:56232996-56233018 AAGGAAAAGCTGCAGGGGGGAGG + Intronic
1192157398 X:68756880-68756902 AGAGAGAAGCAGCAGGGAGATGG + Intergenic
1192956535 X:76076386-76076408 ACTCAGAAGCAGCAGAGGAAAGG - Intergenic
1193363954 X:80608368-80608390 AGTGAGAAGTAGAAGGGGCAGGG - Intergenic
1193810897 X:86049549-86049571 AATGAGAAGCCACAGATGGATGG + Intergenic
1193812910 X:86072843-86072865 AATGGGAAGAAACAGGGGCAGGG - Intergenic
1195101607 X:101560588-101560610 AATGAGAAGGAACAAGGGAAAGG - Intergenic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1195206045 X:102601124-102601146 AATCAGCAGCAGCAGGGGGTGGG - Exonic
1195301025 X:103530173-103530195 AATGGGAAGCTGCTGGGGGTGGG - Intergenic
1195696231 X:107669609-107669631 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1195881792 X:109600625-109600647 GATGAGAATCTGGAGGGGGAGGG + Intergenic
1196466376 X:115975196-115975218 AAAGTGAAAAAGCAGGGGGATGG + Intergenic
1196613341 X:117738873-117738895 AAAGAAAAGGAGCAGGGGGATGG + Intergenic
1196797090 X:119511074-119511096 CCTGGGAAGCAGCAAGGGGAAGG - Intergenic
1197160121 X:123313547-123313569 AGTGAGAAGGAAAAGGGGGAAGG - Intronic
1197734478 X:129840682-129840704 CTTGAGTAACAGCAGGGGGAGGG - Intronic
1198133977 X:133728338-133728360 AATGAGAAGGAGAAGGAGAAAGG + Intronic
1198708422 X:139475184-139475206 AATGAAAAGCAGCAAGCAGAAGG + Intergenic
1199399167 X:147376729-147376751 AGTGAGGAACAGCAGGGGCAAGG + Intergenic
1199819186 X:151427651-151427673 AATGAGAAGCAGTGGGGGCTGGG + Intergenic
1200010001 X:153113745-153113767 TTTGAGAACCAGAAGGGGGAAGG - Intergenic
1200029599 X:153286177-153286199 TTTGAGAACCAGAAGGGGGAAGG + Intergenic
1200379711 X:155822203-155822225 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200379719 X:155822227-155822249 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200836253 Y:7734655-7734677 AATGAGAAGAAGGTGGGTGAGGG - Intergenic
1200985843 Y:9303263-9303285 AATGACTGGCAGCAGGGGGTGGG + Intergenic
1201300204 Y:12498611-12498633 AATAAGAAGAAGGAGGAGGAGGG - Intergenic
1201300227 Y:12498706-12498728 AAAGAGGAGAAGGAGGGGGAAGG - Intergenic
1201461744 Y:14233036-14233058 AATGAGGAGGAGGAGGGGGAGGG - Intergenic
1202124733 Y:21557632-21557654 AATGACTGGCAGCAGGGGGTGGG - Intergenic
1202154275 Y:21871748-21871770 AATGACTGGCAGCAGGGGGTGGG + Intergenic
1202195251 Y:22294442-22294464 AATGACTGGCAGCAGGGGGTGGG + Intergenic
1202341931 Y:23878711-23878733 AATGAAAAGAACCAGAGGGATGG - Intergenic
1202528837 Y:25791374-25791396 AATGAAAAGAACCAGAGGGATGG + Intergenic