ID: 961689348

View in Genome Browser
Species Human (GRCh38)
Location 3:128657415-128657437
Sequence AAAAAACGAGCCGGGCGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42394
Summary {0: 1, 1: 2, 2: 128, 3: 5517, 4: 36746}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961689341_961689348 6 Left 961689341 3:128657386-128657408 CCACACCCAGCCCAGAAAAGTTT 0: 1
1: 5
2: 38
3: 369
4: 1902
Right 961689348 3:128657415-128657437 AAAAAACGAGCCGGGCGCCGTGG 0: 1
1: 2
2: 128
3: 5517
4: 36746
961689344_961689348 -4 Left 961689344 3:128657396-128657418 CCCAGAAAAGTTTTAAACGAAAA 0: 1
1: 1
2: 8
3: 59
4: 655
Right 961689348 3:128657415-128657437 AAAAAACGAGCCGGGCGCCGTGG 0: 1
1: 2
2: 128
3: 5517
4: 36746
961689345_961689348 -5 Left 961689345 3:128657397-128657419 CCAGAAAAGTTTTAAACGAAAAA 0: 1
1: 1
2: 5
3: 70
4: 600
Right 961689348 3:128657415-128657437 AAAAAACGAGCCGGGCGCCGTGG 0: 1
1: 2
2: 128
3: 5517
4: 36746
961689342_961689348 1 Left 961689342 3:128657391-128657413 CCCAGCCCAGAAAAGTTTTAAAC 0: 1
1: 0
2: 9
3: 69
4: 733
Right 961689348 3:128657415-128657437 AAAAAACGAGCCGGGCGCCGTGG 0: 1
1: 2
2: 128
3: 5517
4: 36746
961689343_961689348 0 Left 961689343 3:128657392-128657414 CCAGCCCAGAAAAGTTTTAAACG 0: 1
1: 0
2: 3
3: 21
4: 247
Right 961689348 3:128657415-128657437 AAAAAACGAGCCGGGCGCCGTGG 0: 1
1: 2
2: 128
3: 5517
4: 36746
961689340_961689348 9 Left 961689340 3:128657383-128657405 CCACCACACCCAGCCCAGAAAAG 0: 2
1: 23
2: 159
3: 1041
4: 4888
Right 961689348 3:128657415-128657437 AAAAAACGAGCCGGGCGCCGTGG 0: 1
1: 2
2: 128
3: 5517
4: 36746

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961689348 Original CRISPR AAAAAACGAGCCGGGCGCCG TGG Intronic
Too many off-targets to display for this crispr