ID: 961692605

View in Genome Browser
Species Human (GRCh38)
Location 3:128680862-128680884
Sequence GGCACTGCCGCCAGAGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961692598_961692605 15 Left 961692598 3:128680824-128680846 CCGAATGCCGGATAGGTCAAAGA 0: 1
1: 0
2: 1
3: 4
4: 45
Right 961692605 3:128680862-128680884 GGCACTGCCGCCAGAGGGCGCGG 0: 1
1: 0
2: 3
3: 19
4: 197
961692596_961692605 22 Left 961692596 3:128680817-128680839 CCGGAAGCCGAATGCCGGATAGG 0: 1
1: 0
2: 0
3: 2
4: 18
Right 961692605 3:128680862-128680884 GGCACTGCCGCCAGAGGGCGCGG 0: 1
1: 0
2: 3
3: 19
4: 197
961692599_961692605 8 Left 961692599 3:128680831-128680853 CCGGATAGGTCAAAGACAGCGCC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 961692605 3:128680862-128680884 GGCACTGCCGCCAGAGGGCGCGG 0: 1
1: 0
2: 3
3: 19
4: 197
961692595_961692605 23 Left 961692595 3:128680816-128680838 CCCGGAAGCCGAATGCCGGATAG 0: 1
1: 0
2: 0
3: 4
4: 24
Right 961692605 3:128680862-128680884 GGCACTGCCGCCAGAGGGCGCGG 0: 1
1: 0
2: 3
3: 19
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961692605 Original CRISPR GGCACTGCCGCCAGAGGGCG CGG Intronic
900135699 1:1116091-1116113 GGCGCCACCGCCTGAGGGCGGGG - Exonic
900564004 1:3323562-3323584 GGCACTGGCGGCAGCTGGCGGGG - Intronic
900706357 1:4082585-4082607 GGGACTGCCGCCGGAGTGAGAGG + Intergenic
901762236 1:11478864-11478886 GGCCCTGGCGCCCGCGGGCGGGG - Intergenic
902396548 1:16135072-16135094 GGCACTGACGCAGGAGGGCCAGG - Exonic
904500241 1:30908878-30908900 GGGACTGGGGTCAGAGGGCGCGG - Intergenic
904618180 1:31761007-31761029 GGCACCGCCCCCAGGGGCCGAGG - Intronic
905907213 1:41627095-41627117 AGCACTGGGGCCAGAGGGCAGGG + Intronic
906459950 1:46029494-46029516 GGCACTGCCCCCAGACGCCCAGG + Exonic
907373189 1:54016127-54016149 GGCATTCCAGGCAGAGGGCGTGG + Intronic
911244810 1:95505174-95505196 GGCACTCCAGCCAGAGGAGGAGG - Intergenic
914255290 1:145957684-145957706 GGCAGTGCTGCGAGAGGCCGTGG - Exonic
916609264 1:166374333-166374355 AGCACTGTGGCCAGAGGGCTGGG - Intergenic
916890180 1:169106327-169106349 GGCACTCCCGCCAGGAGCCGAGG - Intronic
917980596 1:180266643-180266665 GGCACCTCAGGCAGAGGGCGTGG - Intronic
922465260 1:225842269-225842291 GGCACTGGCCGCAGAGGGCGGGG - Intronic
922577456 1:226671751-226671773 GGCACTGCAGACAGAGGGAGCGG + Intronic
1063300610 10:4846006-4846028 GGCACTGGGGCCACAGGGGGCGG - Intronic
1069592175 10:69648921-69648943 GGCACTGCAGCCTGAGGGCCGGG - Intergenic
1071469857 10:85976373-85976395 GGCACTGCCCCCAGGGAGTGGGG + Intronic
1074158522 10:110818444-110818466 GGCTCTGCCACCACAGGGCCCGG - Intronic
1075788114 10:125063913-125063935 GGCACTGCAGCCTGGGGGTGGGG - Intronic
1076639669 10:131905757-131905779 GGCTCTGCGGCCAGTCGGCGTGG - Intronic
1076721664 10:132395964-132395986 CGCGCGGCCGCCGGAGGGCGAGG + Intergenic
1077143873 11:1036330-1036352 GGCACAGCAGCCAGCGGGGGAGG - Intronic
1077417612 11:2432150-2432172 GGCACTGCTGCCAGGGGAGGAGG + Intergenic
1077506167 11:2930872-2930894 GGCAGTGCCGGCAGAGGGCAGGG + Intergenic
1078467116 11:11558644-11558666 GCCCCTGCAGCCAGAGGGCTGGG + Intronic
1081965076 11:47164523-47164545 GGCTCAGCTGCCAGAGGGTGAGG + Exonic
1083207474 11:61161343-61161365 GGCTCTGCCGCAGGCGGGCGGGG - Intronic
1083457105 11:62786684-62786706 CCCGCTGCCGCCAGGGGGCGCGG + Exonic
1083777884 11:64903052-64903074 AGCCCTGCCACCAGAGGACGCGG - Intronic
1084323869 11:68388065-68388087 AGCACAGCAGGCAGAGGGCGGGG + Intronic
1090385751 11:126356638-126356660 GGAACTGCTGCCAGAAGGCTGGG + Intronic
1091599613 12:1909868-1909890 GGCACTGGTGCCAGAGGGCCAGG - Intronic
1091923073 12:4321155-4321177 GGCTCCGCCGCCATAGGCCGAGG - Intergenic
1092337079 12:7642632-7642654 GGAACTGCCCCCAGAGGTGGAGG + Intergenic
1094845185 12:34358378-34358400 GGCACTTTCGCCAGTGGGGGGGG + Intergenic
1095719659 12:45386772-45386794 GGCACGGAGGCCAGAGGGCCAGG - Intronic
1096309211 12:50505311-50505333 CGCACGGCCGCCAGAGCGCGCGG - Intronic
1096774268 12:53954809-53954831 GGCACGGCCGCCAGGGGGAGGGG - Intergenic
1099523201 12:83689366-83689388 GGCACTGCTGCCAGGGTGGGTGG - Intergenic
1101747011 12:107550136-107550158 GGCATTGAAGCCAGAGGGCCAGG + Intronic
1104273683 12:127305377-127305399 GGCACTGCCTCCAGGAGGTGAGG + Intergenic
1104390567 12:128387969-128387991 AGCTCTGCCACCAGAGGGCGGGG - Intronic
1106305518 13:28505683-28505705 GGCACTGCAGCCTGAAGGTGGGG + Intergenic
1106602470 13:31199909-31199931 CTCCCGGCCGCCAGAGGGCGCGG + Intergenic
1118730215 14:68660743-68660765 GGCAATGCTCCCAGAGGGGGCGG + Intronic
1120527435 14:85593386-85593408 GGCCCTGCAGCCAGAAGGTGAGG - Intronic
1120748533 14:88175525-88175547 GGCAGCCCTGCCAGAGGGCGAGG - Intergenic
1121074957 14:91060301-91060323 GGCCCGGCCGGCAGAGGGCGGGG + Intronic
1121337563 14:93086601-93086623 GGCACACCCGCCAGAGGGCATGG - Intronic
1121437497 14:93928958-93928980 GGCAGTGCCCCCAGGGGGCCCGG - Exonic
1122031578 14:98916162-98916184 GGCACTGCTGGGAGAGGGCTGGG - Intergenic
1122163087 14:99800972-99800994 GGCCCTGCTGTCAGAGGGAGGGG + Intronic
1122214316 14:100193151-100193173 GACACCTCGGCCAGAGGGCGGGG + Intergenic
1123030540 14:105449256-105449278 GGCTGTGCCGCCAGGGGGCAGGG - Intronic
1123701665 15:22918658-22918680 GGCACAGCGGGCACAGGGCGTGG + Intronic
1123774201 15:23562135-23562157 GGCACTGCCGGCTGCCGGCGGGG - Intergenic
1131094129 15:89645418-89645440 GCAACTGCAGTCAGAGGGCGGGG - Exonic
1131290493 15:91102720-91102742 GGGAGTGCTGCCAGAGGGCAGGG + Intronic
1131515289 15:93072889-93072911 GGCACTGCCGGCCGGGCGCGCGG - Intronic
1132055308 15:98647669-98647691 GCGGCGGCCGCCAGAGGGCGCGG - Intergenic
1132491598 16:234799-234821 GGAAGTGACGCCAGGGGGCGGGG + Exonic
1132569356 16:637287-637309 GGCAGGGGCGGCAGAGGGCGGGG + Intronic
1132609308 16:807408-807430 GGCCCGGCGGCCAGAGGGAGCGG - Intronic
1132859124 16:2061411-2061433 GCCACTGCCACCAGCGGTCGGGG - Intronic
1132946823 16:2536399-2536421 GTCTGTGTCGCCAGAGGGCGAGG + Intergenic
1133012996 16:2925245-2925267 GGGACTTTCTCCAGAGGGCGGGG + Intronic
1135200053 16:20429606-20429628 GGCAGTGGCACCAGAGGGCGGGG + Intronic
1135218646 16:20594003-20594025 GGCAGTGGCACCAGAGGGCGGGG - Intergenic
1137665221 16:50245909-50245931 GGCGCTGCCGCGGGAGGGAGCGG - Intergenic
1140453944 16:75093772-75093794 GGCACACCTGCCAGAGGGCAGGG - Intronic
1141079147 16:81035798-81035820 GCCACTTCCGGCAGGGGGCGAGG - Intergenic
1141219787 16:82058817-82058839 GGCACTGTGGACAGATGGCGGGG + Intronic
1142369027 16:89667747-89667769 AGCACTGCAGGCAGAGGGGGAGG + Intronic
1145230837 17:21172209-21172231 GGCAGTGCTGCCAGGGGGCGGGG + Intronic
1146456451 17:33013342-33013364 GGCACAGCAGCCAGCGGGTGGGG - Exonic
1147786021 17:42979522-42979544 GGCCCTGCCGTCCGAGGGCCTGG - Intronic
1151674127 17:75589218-75589240 GCGGCGGCCGCCAGAGGGCGAGG + Intergenic
1152404274 17:80087535-80087557 GACACTGCTGCCTGCGGGCGAGG + Intronic
1153622191 18:6989772-6989794 GGCACTGCCTCCAGAGTGCGTGG - Intronic
1156488652 18:37483358-37483380 GGCACGCCCACCAGAGGGAGGGG - Intronic
1160619287 18:80159800-80159822 GGCGCTGCCGCCAGGCGGCGTGG - Exonic
1160755950 19:757273-757295 GGCACTCCGCCCAGAGGACGGGG + Exonic
1160927857 19:1555715-1555737 GGCCCTGGCGCGAGAGTGCGTGG - Exonic
1161585467 19:5103103-5103125 GGCACTGCTGCCAGTGGGGCCGG + Intronic
1162042497 19:7979232-7979254 GACTCTGCCGGCAGAGGGCAGGG + Intronic
1163116442 19:15191719-15191741 GGCACTGCGGCCAGAGGGAGCGG - Intronic
1163822027 19:19501422-19501444 GGCACTGCCGGCAGCAGGCCAGG - Intronic
1164207171 19:23068686-23068708 GGCACTGCCCTCAGAAGGCATGG - Intergenic
1164210777 19:23095614-23095636 GGCACTGCCCTCAGAAGCCGTGG + Intronic
1165826134 19:38706908-38706930 GGCACTGCCGCATGAGGTCCAGG + Intronic
1166838406 19:45681669-45681691 CGCGCTGCCGCCAGAGGGCGGGG - Intronic
1168240488 19:55086644-55086666 GGTCCTGGGGCCAGAGGGCGGGG - Intronic
1168427807 19:56252988-56253010 GGCTCTGCCACTAGAGGGGGTGG - Intronic
925306728 2:2851903-2851925 GGGACTGACGCCAGAAGGCAGGG + Intergenic
927219811 2:20696396-20696418 GCCCCTGCCCCCAGAGGGCCAGG - Intronic
932085658 2:68756400-68756422 GTCACTTCAGCCAGAGGGGGAGG - Intronic
937295587 2:120807988-120808010 GGCCCTGCTGTCAGAGGGCGTGG + Intronic
937922015 2:127137519-127137541 GCCCCTGCCGCGAGAGGACGCGG - Intergenic
938296431 2:130182226-130182248 GGCGCAGCCGCTAGGGGGCGCGG + Exonic
938628222 2:133135280-133135302 AGCACTGCAGGCAGAGGGAGAGG + Intronic
945245209 2:207711552-207711574 GCCACTGCCGGGAGAGAGCGCGG - Intronic
947702813 2:232249325-232249347 GACACTGACTCCAGAGGGCAAGG + Exonic
948594919 2:239073756-239073778 GGCACTCCCGCCGCAGGGCTGGG + Intronic
948738230 2:240025126-240025148 GGAGCCGCCGCCAGAGGCCGGGG + Intronic
1168913307 20:1467008-1467030 GCCGCGGTCGCCAGAGGGCGCGG - Intronic
1172357550 20:34290681-34290703 GCCACTGGGGCCAGAGGGAGGGG - Intronic
1172837382 20:37881805-37881827 GGCCCTGCTGCCTGAGGACGGGG + Intergenic
1173773235 20:45681899-45681921 TGCACTGCCTCCAGAGAGTGAGG + Intergenic
1173920960 20:46744328-46744350 GGCAATGCAACCACAGGGCGGGG + Intergenic
1174320598 20:49738973-49738995 GGCACAGCCCCCAGTGGGCCTGG - Intergenic
1175191775 20:57216487-57216509 GGCGCTGTCTCCTGAGGGCGAGG + Intronic
1175918292 20:62437889-62437911 GGCCCTGCCGTCAGAGGGACAGG - Intergenic
1176257512 20:64159929-64159951 GGCCCTGCAGGCAGAGGGTGGGG - Intronic
1176304177 21:5114725-5114747 GGTGCTGCCACCAGGGGGCGTGG - Intergenic
1179852879 21:44147305-44147327 GGTGCTGCCACCAGGGGGCGTGG + Intergenic
1180159042 21:45990915-45990937 GGGGCTGCTGCCAGAGGCCGCGG + Intronic
1180612943 22:17109301-17109323 GGCACTGGCGGGGGAGGGCGAGG + Exonic
1180750311 22:18119863-18119885 GGCAGAGCCTCCAGAGGGCACGG - Intronic
1181489569 22:23253188-23253210 GGCAGTGCCCCGAGAGGGCATGG - Intronic
1181934560 22:26429426-26429448 GACGCCGCCGCCCGAGGGCGCGG - Exonic
1183984437 22:41561824-41561846 GGCACAGCCCCCGGAGGGCAGGG + Intronic
1184033836 22:41909496-41909518 GGCAGTGCAGGCAGAGGGCACGG - Intergenic
1184100195 22:42338025-42338047 GTCACTGTGGCCAGAGGGAGGGG + Intronic
1184431120 22:44442013-44442035 GCCACGGCCCTCAGAGGGCGTGG + Intergenic
1184590079 22:45476254-45476276 GGCCATGCAGCCAGAGGGTGCGG + Intergenic
1184655625 22:45940683-45940705 GACAGTGCCGCCAGAGGCCAGGG + Intronic
1185038288 22:48490624-48490646 GGCTCTGGCCCCAGATGGCGCGG + Intronic
1185245650 22:49771504-49771526 GGCGCTGCTCCCAGAGCGCGAGG - Intergenic
1185264678 22:49894772-49894794 GTCACTGGGGCCAGAGGGAGTGG - Intergenic
1185274565 22:49944731-49944753 GGCACTGCAGCCTGAGGTCTGGG - Intergenic
949342548 3:3045188-3045210 TGCCCTGCCCCCAGAGGGCAAGG - Intronic
949895890 3:8767446-8767468 GGCCGAGGCGCCAGAGGGCGCGG - Exonic
950103594 3:10374472-10374494 GGCAGAGCCTCCAGAGGGCATGG - Intronic
950518049 3:13480226-13480248 AGCTCTGCCCCCAGAGGACGCGG + Exonic
950669120 3:14514561-14514583 GGCACTGGAGCCAGAGTGCAAGG + Intronic
951476980 3:23117565-23117587 GGCACTGCAGGCAGAGGACAGGG - Intergenic
951640353 3:24829276-24829298 GGGCCTGGCGCCAGGGGGCGGGG + Intergenic
951986371 3:28626114-28626136 GCCACTGCCGTCAGAGGTCCAGG + Intergenic
954751401 3:52816158-52816180 GTCACTGCCCACAGAGGACGAGG + Intronic
959952650 3:112197300-112197322 GTCACTTCAGCCAGAGGGGGAGG + Intronic
961692605 3:128680862-128680884 GGCACTGCCGCCAGAGGGCGCGG + Intronic
961768277 3:129229089-129229111 GGCACTGCAGCCACAGAGAGAGG - Intergenic
968427537 4:533599-533621 GGCACTGCAGGCAGGGGGAGGGG + Intronic
968453239 4:684758-684780 GGCAGCCCCGGCAGAGGGCGGGG + Exonic
977607201 4:98995499-98995521 GGCACCGCCGGCGGGGGGCGGGG + Intergenic
982143100 4:152348840-152348862 GGCACTTCCACCAGAGGGTGTGG - Intronic
985254287 4:188054440-188054462 GGCAGTGCCGAGAGAGGGCCCGG - Intergenic
985894059 5:2738832-2738854 GTCAGGGCCGCCAGAGGTCGCGG + Intergenic
990475832 5:56160873-56160895 GGCTCTGCAGCCAGATGGCTTGG + Intronic
997294755 5:132762437-132762459 GGCCCTGGGGCCAGAGGGCGAGG - Intronic
998769358 5:145524359-145524381 GGCACTCCAGCCAGAGCGCTAGG + Intronic
1002904305 6:1436484-1436506 GGCACCTCCGCCAGTGGGCCCGG + Intergenic
1003872901 6:10415782-10415804 GGCGCTGCGGCCCGAGGGGGTGG - Intronic
1003926486 6:10882203-10882225 GAAACTGCAGCCAGAGGGTGGGG + Intronic
1003927129 6:10887020-10887042 GGCAGCGCCCCCAGCGGGCGGGG + Exonic
1005883632 6:30078194-30078216 GGCACTGCAGCCAGAGCACAAGG - Intergenic
1007262459 6:40573330-40573352 GGCACTGGGGCCAGATGGCCTGG + Intronic
1007409650 6:41654342-41654364 GGCAGGGCCCCCAGAGGGCAGGG - Intergenic
1012483737 6:99696861-99696883 GCCACTGCTGCCAGGGGGTGAGG + Intergenic
1014205510 6:118651592-118651614 GGCTCTGCCGGCGGAGGGGGCGG - Intronic
1015494466 6:133865807-133865829 GGCAGTGCATCCAGAGGGAGGGG - Intergenic
1019064984 6:169288938-169288960 GCCACTGCCTCCAGGGGGCCTGG - Intergenic
1019219956 6:170465175-170465197 AGCTCTGCAGCCAGAGGGTGAGG + Intergenic
1019449571 7:1090392-1090414 GGCTCTGCCGCCAGTGGGGAGGG - Intronic
1019449603 7:1090489-1090511 GGCTCTGCCGCCAGTGGGGAGGG - Intronic
1019449619 7:1090538-1090560 GGCTCTGCCGCCAGTGGGTAGGG - Intronic
1019449650 7:1090635-1090657 GGCTCTGCCGCCAGTGGGGAGGG - Intronic
1019522908 7:1468609-1468631 GGCACTGGGGCCGGAGGGCTTGG + Intergenic
1019536192 7:1530981-1531003 GTCACGGCCGCCTGGGGGCGCGG + Intronic
1019689606 7:2403431-2403453 GGCACTGGCTCGCGAGGGCGGGG + Intergenic
1019983307 7:4637676-4637698 GGGGATGCCGCCAGAGGGTGTGG + Intergenic
1023797792 7:43808205-43808227 GTCACTGCTGCCACAGGGAGAGG - Intergenic
1023929032 7:44693758-44693780 GGCACAGGGACCAGAGGGCGGGG - Intronic
1026212743 7:68321270-68321292 GGGACAGCTGCCAGAGGGCCTGG - Intergenic
1026470793 7:70693250-70693272 TGCAGTGCCCCCAGAGGGTGTGG - Intronic
1030138932 7:106285334-106285356 GGCACGGGCGCGGGAGGGCGGGG + Intronic
1035251371 7:157599701-157599723 GTCACAGCTGCCAGAGGCCGGGG - Intronic
1037886316 8:22598270-22598292 GGCACCTCCTCCAGAGGGAGGGG - Intronic
1039919421 8:41882794-41882816 GGCCCTGACTCCAGAGGGAGAGG - Intronic
1042591735 8:70403528-70403550 GGGACCGCCGCCGGAGTGCGCGG - Intronic
1044290621 8:90464764-90464786 GACACTGCGGCCAGAGTGCTTGG - Intergenic
1048216369 8:132499388-132499410 GGCTCTGTCTGCAGAGGGCGAGG - Intergenic
1048492771 8:134909920-134909942 GGCACTGGGGTCAGAGGGGGTGG - Intergenic
1049221626 8:141431262-141431284 GCCAGCGCCGCCAGAGGGAGTGG - Exonic
1049648886 8:143754167-143754189 GTCACTTCAGCCAGAGGGGGAGG + Intergenic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049731863 8:144182253-144182275 GGCACTGCAGCCAGGAGGCGAGG + Intronic
1057741075 9:97711560-97711582 GGCGCTGCCGCCAGAGGAGGGGG + Intergenic
1060519086 9:124283740-124283762 GGCACTCCAGGCAGAGGGCATGG - Intronic
1061248070 9:129411626-129411648 GCCACTGTCGCCAGAGTGCTAGG - Intergenic
1061904360 9:133689065-133689087 GGCACTCCAGCCAGAGGTCTCGG + Intronic
1062346684 9:136118377-136118399 GGCTCTGCAGCCAGGGGGCCCGG - Intronic
1062398153 9:136360860-136360882 CTCACTGCCTCCAGAGGGCCTGG - Intronic
1062425875 9:136505947-136505969 GGCACTGCTGGCCGAGGGCTGGG - Intronic
1062446898 9:136598951-136598973 GGCACTCCCGCCAGGAGGCTGGG - Intergenic
1062498036 9:136840768-136840790 GGCTCTGCCCCGAGAGGGCCAGG - Exonic
1062549065 9:137077748-137077770 GCCCCTGCCCCCAGAGCGCGTGG + Exonic
1187455752 X:19439969-19439991 GGCACTGGGGGCAGAGGGTGAGG + Intronic
1190172420 X:48122090-48122112 GTCACAGCCACCAGAGGGAGAGG + Intergenic
1190180083 X:48184688-48184710 GTCACAGCCACCAGAGGGAGAGG - Intergenic
1190184031 X:48219383-48219405 GTCACAGCCACCAGAGGGAGAGG + Intronic
1190189958 X:48268832-48268854 GTCACAGCCACCAGAGGGAGAGG + Intronic
1190193100 X:48293908-48293930 GTCACAGCCACCAGAGGGAGAGG - Intergenic
1190197185 X:48329525-48329547 GTCACAGCCACCAGAGGGAGAGG + Intergenic
1190199073 X:48344887-48344909 GTCACAGCCACCAGAGGGAGAGG - Intergenic
1190204891 X:48394770-48394792 GCCACAGCCACCAGAGGGAGAGG + Intergenic
1190205645 X:48400633-48400655 GCCACAGCCACCAGAGGGAGAGG - Intergenic
1190658713 X:52635337-52635359 GTCACAGCCACCAGAGGGAGAGG + Intergenic
1190659605 X:52642521-52642543 GTCACAGCCACCAGAGGGAGAGG - Intergenic
1190663922 X:52679903-52679925 GTCACAGCCACCAGAGGGAGAGG + Intronic
1190665832 X:52695357-52695379 GTCACAGCCACCAGAGGGAGAGG - Intronic
1190673586 X:52763053-52763075 GTCACAGCCACCAGAGGGAGAGG + Intronic
1190675500 X:52778519-52778541 GTCACAGCCACCAGAGGGAGAGG - Intronic
1190677122 X:52791823-52791845 GTCACAGCCACCAGAGGGAGAGG + Intergenic
1193478430 X:81996374-81996396 GACAGAGCCACCAGAGGGCGGGG + Intergenic
1197392024 X:125878736-125878758 GCCACTGCTGCCAGAGGATGGGG + Intergenic
1199599995 X:149536116-149536138 GTCACTGCCTCCAGATGGAGGGG + Intergenic