ID: 961695628

View in Genome Browser
Species Human (GRCh38)
Location 3:128702293-128702315
Sequence CTATAAACAAAGCTGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961695628_961695633 9 Left 961695628 3:128702293-128702315 CCAGTCTCCAGCTTTGTTTATAG No data
Right 961695633 3:128702325-128702347 TTCAAAATCTCAGTGATGACAGG No data
961695628_961695634 26 Left 961695628 3:128702293-128702315 CCAGTCTCCAGCTTTGTTTATAG No data
Right 961695634 3:128702342-128702364 GACAGGTGTTTTAACTCGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961695628 Original CRISPR CTATAAACAAAGCTGGAGAC TGG (reversed) Intergenic
No off target data available for this crispr