ID: 961696808

View in Genome Browser
Species Human (GRCh38)
Location 3:128710941-128710963
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961696806_961696808 -6 Left 961696806 3:128710924-128710946 CCAGCTGGCACCTCATTTCCCAC No data
Right 961696808 3:128710941-128710963 TCCCACTGCCTCTTACATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr