ID: 961698856

View in Genome Browser
Species Human (GRCh38)
Location 3:128726303-128726325
Sequence CGTCGCGAGGGCTCCCGCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961698856_961698863 6 Left 961698856 3:128726303-128726325 CCTCGGCGGGAGCCCTCGCGACG 0: 1
1: 0
2: 1
3: 12
4: 60
Right 961698863 3:128726332-128726354 GCCCGGAGCCCCCAGCGCAGCGG 0: 1
1: 0
2: 6
3: 29
4: 280
961698856_961698872 23 Left 961698856 3:128726303-128726325 CCTCGGCGGGAGCCCTCGCGACG 0: 1
1: 0
2: 1
3: 12
4: 60
Right 961698872 3:128726349-128726371 CAGCGGCCGCGGTAAGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 59
961698856_961698871 22 Left 961698856 3:128726303-128726325 CCTCGGCGGGAGCCCTCGCGACG 0: 1
1: 0
2: 1
3: 12
4: 60
Right 961698871 3:128726348-128726370 GCAGCGGCCGCGGTAAGCAGCGG 0: 1
1: 0
2: 0
3: 7
4: 149
961698856_961698866 12 Left 961698856 3:128726303-128726325 CCTCGGCGGGAGCCCTCGCGACG 0: 1
1: 0
2: 1
3: 12
4: 60
Right 961698866 3:128726338-128726360 AGCCCCCAGCGCAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 34
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961698856 Original CRISPR CGTCGCGAGGGCTCCCGCCG AGG (reversed) Exonic