ID: 961703607

View in Genome Browser
Species Human (GRCh38)
Location 3:128766328-128766350
Sequence TTGAATAACTGTTATTTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 406}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961703607_961703613 23 Left 961703607 3:128766328-128766350 CCAAGTAAATAACAGTTATTCAA 0: 1
1: 0
2: 3
3: 42
4: 406
Right 961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG 0: 1
1: 0
2: 0
3: 1
4: 54
961703607_961703614 24 Left 961703607 3:128766328-128766350 CCAAGTAAATAACAGTTATTCAA 0: 1
1: 0
2: 3
3: 42
4: 406
Right 961703614 3:128766375-128766397 TCCTGGGTAACCACCGTCATGGG 0: 1
1: 0
2: 0
3: 1
4: 44
961703607_961703610 8 Left 961703607 3:128766328-128766350 CCAAGTAAATAACAGTTATTCAA 0: 1
1: 0
2: 3
3: 42
4: 406
Right 961703610 3:128766359-128766381 TAGGACACCCAAGAAGTCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 122
961703607_961703609 7 Left 961703607 3:128766328-128766350 CCAAGTAAATAACAGTTATTCAA 0: 1
1: 0
2: 3
3: 42
4: 406
Right 961703609 3:128766358-128766380 TTAGGACACCCAAGAAGTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961703607 Original CRISPR TTGAATAACTGTTATTTACT TGG (reversed) Intronic
901442989 1:9290877-9290899 TTTGAGAACTGTTGTTTACTTGG - Intergenic
903891019 1:26570654-26570676 TTGAATACCTGCCATGTACTAGG + Intronic
903988070 1:27243718-27243740 TTCAATAAATATTATTTAATAGG + Intronic
905087382 1:35393806-35393828 TTGAGTACCTGCTATTTCCTAGG + Intronic
905258182 1:36699028-36699050 TTGATTAACTGTTACTTTCCTGG - Intergenic
905606585 1:39306055-39306077 TTGAATACCTGCTATGTGCTAGG - Intronic
906730199 1:48074371-48074393 CTGAATAACTTTTAATTAGTTGG - Intergenic
906749799 1:48248597-48248619 TTGAACAGCTGTTATTTTCTGGG - Exonic
906850139 1:49239722-49239744 TTGAATACCTGTTATGTACCAGG + Intronic
907065160 1:51474539-51474561 TTTAATTATAGTTATTTACTTGG + Intronic
907152742 1:52304660-52304682 TTGAATAAACATTATGTACTTGG + Intronic
907990888 1:59581667-59581689 TTGAATAACTGCTATGTGCCAGG + Intronic
910103522 1:83604658-83604680 TTGAATATCTGCCATGTACTTGG + Intergenic
911075025 1:93864736-93864758 TTGAGTACTTGTTATTTACTAGG + Intergenic
911142308 1:94518152-94518174 TTGAATAACTTTTTTATATTTGG + Exonic
913361250 1:117982674-117982696 TTAAATTACTGTTAATTTCTTGG - Intronic
916248686 1:162714105-162714127 TTGAATGCTTTTTATTTACTTGG + Intronic
916563839 1:165956105-165956127 TTGAATACCTGTTGTGTACCAGG + Intergenic
917240826 1:172946651-172946673 TAGAATAGCTGTGATTTCCTGGG - Intergenic
917636092 1:176938391-176938413 TTGAAAAATTTTTATTTAGTGGG - Intronic
918349430 1:183638378-183638400 TTGAGTACCTATTATGTACTAGG - Intronic
918594545 1:186278008-186278030 TTGAATAACAGATATGTACCAGG + Intergenic
918653957 1:187000898-187000920 TTCAAGAACTATTATTTAGTAGG - Intergenic
919255739 1:195121646-195121668 TTGGGTAACTGATATTTTCTGGG + Intergenic
919505938 1:198397575-198397597 CTGAATATCTTTTATTTACCAGG + Intergenic
920256732 1:204660423-204660445 TTGGACATCTGCTATTTACTAGG - Intronic
921351347 1:214239037-214239059 TTCAATAAATGTATTTTACTGGG - Intergenic
923545123 1:234918307-234918329 CTGAACAAGTGTTATTTAATGGG + Intergenic
923872043 1:238005674-238005696 TCGAATACCTGCTATGTACTAGG + Intergenic
924551048 1:245077652-245077674 TGGGAAAACTGTTATTTACATGG + Intronic
1064677868 10:17780024-17780046 TATAATAACTGTTTTTTTCTTGG + Intronic
1064948748 10:20822115-20822137 TACAATAACTGTTATTTGTTGGG - Intronic
1065378981 10:25069821-25069843 TTGAATATCTATTATATAGTAGG - Intergenic
1066670251 10:37829555-37829577 CTCAATAACTGTTTTTTATTTGG - Exonic
1068046383 10:51891559-51891581 TTGAGTATCTATCATTTACTAGG + Intronic
1068532089 10:58200770-58200792 TTGAGTAACTGATAATAACTAGG + Intronic
1068612105 10:59071591-59071613 TTGAACAACTACTATTTCCTAGG - Intergenic
1069055552 10:63840774-63840796 TTGAACATCTGTTATCTACAGGG + Intergenic
1070421149 10:76238523-76238545 TTGCATATCTGTTATTTACAGGG + Intronic
1070839177 10:79471316-79471338 CTGAATAACTGGTGTTTATTTGG + Intergenic
1071234357 10:83627522-83627544 TTTAAAAATTGTTTTTTACTTGG - Intergenic
1072181528 10:92986167-92986189 TTGACTGACTTTTATTGACTAGG + Intronic
1072607105 10:96993872-96993894 TGGAATAAATGTTATTACCTAGG - Intergenic
1073424310 10:103447039-103447061 TTAAAAAACTGTTATCTTCTTGG - Exonic
1073501953 10:103947752-103947774 TTGTATAACTTTCATTTTCTGGG + Intergenic
1073663172 10:105500028-105500050 TTCAATTACTGTTACTTAATGGG - Intergenic
1073807945 10:107120205-107120227 TTGAATGAATGTTAACTACTTGG + Intronic
1073960723 10:108924607-108924629 TTGAAGATCTGTTAGTTATTGGG + Intergenic
1074173764 10:110975052-110975074 TTGTATCACTGTTAATTTCTTGG - Intronic
1074204719 10:111272711-111272733 TTGAGTATCTGTTATGTGCTAGG + Intergenic
1075869828 10:125763045-125763067 TTGAATGCCTATTATGTACTAGG - Intronic
1076041226 10:127250935-127250957 TTGAAAAACAGTCATATACTCGG - Intronic
1077829448 11:5848885-5848907 TTAAATAGTGGTTATTTACTTGG + Intronic
1078043822 11:7894388-7894410 TTGAATGATTTTTATGTACTAGG - Intergenic
1079620473 11:22548298-22548320 TTAAATAACTATAATTTGCTAGG + Intergenic
1080409279 11:32008546-32008568 TTGAATACCTGTTATATGCCAGG - Intronic
1080483265 11:32675245-32675267 TTGAGTGACTTTTATATACTGGG - Intronic
1080931125 11:36812331-36812353 TTTAATATCTCTTCTTTACTGGG + Intergenic
1081118981 11:39241056-39241078 GTGACTAGCTGTTTTTTACTTGG + Intergenic
1081367741 11:42257079-42257101 ATGAATAATTCTTATTTAATTGG - Intergenic
1082704045 11:56470704-56470726 TTGTATAATTGTTATATAATAGG - Intergenic
1083015575 11:59449866-59449888 TTGAATAACTGCTATGTTCCAGG + Intergenic
1084923407 11:72491703-72491725 TTTAATAGCTGTTCTTTATTAGG - Intergenic
1085104223 11:73828159-73828181 TTGAATATCTATTATGTGCTAGG + Intronic
1085841779 11:80019752-80019774 ATGAATACCTGTTATGTGCTAGG - Intergenic
1085876906 11:80418534-80418556 CTGTTTGACTGTTATTTACTGGG - Intergenic
1085903621 11:80732875-80732897 TTGAATACCTGTTATGTGCTAGG + Intergenic
1086154544 11:83651165-83651187 TTGAGTACCTATTATGTACTAGG - Intronic
1087421381 11:97929416-97929438 TTGTATGATTTTTATTTACTTGG - Intergenic
1088709033 11:112490066-112490088 TTGAATACCTACTATGTACTAGG + Intergenic
1089502011 11:118938182-118938204 TTGAGCACCTGTTATGTACTAGG - Intronic
1090594722 11:128309030-128309052 CTGAATTACGGCTATTTACTAGG + Intergenic
1091630887 12:2159972-2159994 TTGAGTATCTGTTATGTGCTGGG + Intronic
1093294347 12:17369408-17369430 TTGAATATTAGTTATTTTCTGGG + Intergenic
1093527982 12:20125594-20125616 TATAATAAATGTTATTTGCTTGG - Intergenic
1093611462 12:21164305-21164327 TTGAATAACTGTCATTTGGTGGG - Intronic
1093822136 12:23634159-23634181 CTGAATACCTGCTATTTGCTAGG + Intronic
1094265236 12:28551071-28551093 TTGGGTATCTGTGATTTACTTGG - Intronic
1094427779 12:30333213-30333235 TGGAATAACTCTTAATTCCTAGG + Intergenic
1094581144 12:31735173-31735195 TTTAATACCTGTTATATACCAGG + Intergenic
1095586802 12:43858848-43858870 TTGAATACCTGTTATTTGCAAGG + Intronic
1096426075 12:51504283-51504305 TTGAATACCTGCTATGTACCAGG + Intronic
1098484147 12:71001173-71001195 GTGAATACCTGTTATGTGCTAGG + Intergenic
1098485850 12:71020918-71020940 TTGAATAAATGGTTTGTACTTGG + Intergenic
1098733042 12:74063105-74063127 TTGAAAAACTATCATCTACTAGG + Intergenic
1099068195 12:78010778-78010800 TTAAATAACTTTTATATAATGGG + Intronic
1099169264 12:79344356-79344378 TGGTATAACTGATATTTATTGGG - Intronic
1099701855 12:86093789-86093811 TTAAATTACTCTTATTTACCTGG + Intronic
1100013672 12:89983146-89983168 TTGAATCACTGTTGTGTACCAGG - Intergenic
1100144535 12:91661432-91661454 TTGTATCAATGTTATTTTCTTGG + Intergenic
1100853889 12:98741181-98741203 TTGAATTGCTGTTATTCACCAGG - Intronic
1100901644 12:99248016-99248038 ATGGGTAAGTGTTATTTACTAGG + Intronic
1101265726 12:103084791-103084813 TTGAGATACTGTCATTTACTAGG + Intergenic
1102090372 12:110182354-110182376 TTGAATATCAGTTATGTCCTTGG - Intronic
1104367173 12:128188357-128188379 TAGAATAATTATTATTTTCTGGG - Intergenic
1104826923 12:131718110-131718132 TTAAATAACTGTAACTTAATAGG + Intronic
1106521522 13:30502428-30502450 TAGAATAACTGTTAATTGCAAGG - Intronic
1107325924 13:39242367-39242389 GTGAATAAGTGATATTTTCTTGG - Intergenic
1108558752 13:51622432-51622454 GTAAATGACTGTTCTTTACTTGG + Intronic
1108815020 13:54279977-54279999 GTGAATCACTTTTATTGACTTGG + Intergenic
1108889377 13:55234097-55234119 TTGAATATTTGTTATTTTCTAGG - Intergenic
1110915706 13:81017994-81018016 TAGAGTAACTGTAATTTATTAGG - Intergenic
1111048862 13:82852072-82852094 ATGAGTAACTGTTATATACAGGG + Intergenic
1111183948 13:84704466-84704488 TTTTATAATTGTTATTTATTTGG + Intergenic
1111264982 13:85797763-85797785 TTGCATAACTGTCATTTAAAGGG - Intronic
1112241946 13:97690904-97690926 TTGAGTACCTGTTATGTACTAGG + Intergenic
1112430523 13:99346647-99346669 TTGTCTAGCTGCTATTTACTCGG + Intronic
1114164857 14:20210771-20210793 TTGAATACCTGTTATGTTCTAGG + Intergenic
1114363229 14:21998983-21999005 CTGAAAAACTGTTATGTATTTGG - Intergenic
1115732939 14:36291214-36291236 GTGAATAGCTGCTATTTAATAGG + Intergenic
1115802563 14:37011508-37011530 TTACATATCTGTTATTAACTGGG + Intronic
1115816963 14:37173953-37173975 TTGAGAACCTGTTATATACTAGG + Intergenic
1115922751 14:38394849-38394871 CTTAATAACTGTTGTATACTTGG - Intergenic
1116075993 14:40111746-40111768 TTGAGTACCTGTAATATACTAGG - Intergenic
1116591640 14:46783738-46783760 TTGTATAGCTTTTATTAACTAGG + Intergenic
1117187239 14:53252677-53252699 TTGAATAACTATTGGGTACTGGG - Intergenic
1117517882 14:56520609-56520631 TTGAATATCTATAATATACTAGG - Intronic
1118443589 14:65832789-65832811 TTGAATTACTGTGTTTTTCTTGG + Intergenic
1119062343 14:71487863-71487885 TTGAATATCTGCTATATGCTGGG + Intronic
1119236232 14:73021682-73021704 TTAATAAACTGTTATTTCCTAGG + Intronic
1120391483 14:83914116-83914138 TTAAATAGCTTTTATTTCCTTGG + Intergenic
1121127256 14:91416488-91416510 TTGAATGACTGTCATTTACGTGG - Intronic
1121381447 14:93472834-93472856 TTTATAAACTGTTATCTACTTGG + Intronic
1122699903 14:103581318-103581340 CTGAGTAACCCTTATTTACTTGG - Intronic
1123774269 15:23562734-23562756 TTGAATAACTGGAAATAACTGGG - Intergenic
1125032834 15:35089909-35089931 TTGAATCAGTCTTATTTTCTTGG + Intergenic
1125074268 15:35594741-35594763 TTAAATAACTGTTATATGCAAGG - Intergenic
1125100406 15:35905953-35905975 TTCAATAAATGTTATTTCCAAGG + Intergenic
1125208936 15:37188484-37188506 TTTAAAAAATGTTATTTATTTGG + Intergenic
1125230606 15:37450969-37450991 TAGAATAATTTTTATTTATTAGG - Intergenic
1125867273 15:43064179-43064201 TTGATAAACTATTATTTACCCGG + Intronic
1125905075 15:43384212-43384234 TTGAATGCCTGTTATGTGCTAGG + Intronic
1126003913 15:44238400-44238422 TTGAGCAACTGTTATGTCCTAGG + Intergenic
1127561142 15:60137501-60137523 CTTAATAACTGTAATTTACAAGG + Intergenic
1127786247 15:62357630-62357652 TATAATAACTGTTTTTAACTTGG - Intergenic
1127866878 15:63040756-63040778 TTGAGTACCTGCTATATACTAGG - Intergenic
1128249504 15:66154569-66154591 GTTATTAACTTTTATTTACTGGG + Intronic
1129326808 15:74804169-74804191 TTGAATACCTGCTGTTTGCTAGG + Intergenic
1130538775 15:84806063-84806085 TTGAATCACTGTTATATGCAAGG - Exonic
1131655791 15:94457329-94457351 CTGCATAACTGTTAGTTACCTGG + Intronic
1134013665 16:10873667-10873689 CAGAACAACTGTTCTTTACTTGG + Intergenic
1139754872 16:69134221-69134243 TTGAATGACTGTTATGTACTGGG + Intronic
1140832320 16:78763388-78763410 TTGAATACCTGCTATCTACCAGG + Intronic
1144169129 17:12641782-12641804 TTTAATAACTGTTATTAAAATGG - Intergenic
1145299316 17:21620208-21620230 TAGAATAACTTTTATGTATTTGG + Intergenic
1145350966 17:22083076-22083098 TAGAATAACTTTTATGTATTTGG - Intergenic
1146504908 17:33396367-33396389 CTGAATATCTGCTATGTACTAGG + Intronic
1148681297 17:49475200-49475222 TTGAATAACTATTATGTGCTAGG - Intronic
1149403583 17:56324114-56324136 TTGAATATCTCTTAGTTCCTTGG - Intronic
1149734490 17:58979754-58979776 TTAAATAATTGCTAGTTACTGGG - Intronic
1149818289 17:59748609-59748631 TTGAATACCTTGCATTTACTAGG - Intronic
1149975863 17:61265433-61265455 TTGAATATCTGTTATGTATCAGG - Intronic
1152045287 17:77931021-77931043 TTAAATCACTGTAATTAACTGGG + Intergenic
1153576096 18:6523337-6523359 TTGAGTAACTGCCATTTTCTTGG + Intronic
1153899428 18:9603382-9603404 TTGATAAAATGTTATTTACTAGG + Intronic
1153982749 18:10325419-10325441 TTGAATAAAGTTTGTTTACTTGG - Intergenic
1154338580 18:13485069-13485091 CTGAATACCTGTTGTTTACTAGG + Intronic
1155224065 18:23713066-23713088 TTGAATTACTCTTTCTTACTAGG - Intronic
1155401264 18:25442014-25442036 CTGAATACCTCTTATGTACTGGG + Intergenic
1155420817 18:25653941-25653963 TTGACTAACATTTATCTACTGGG - Intergenic
1157895850 18:51466250-51466272 CTGGAGAACTGTTATTTAATGGG - Intergenic
1157908090 18:51587415-51587437 TTGAAGAATTGTTAGTGACTAGG + Intergenic
1158229008 18:55232986-55233008 TATAATAGCTGATATTTACTTGG - Intronic
1158660391 18:59382019-59382041 TTGAGGAACTGTGATTGACTCGG + Intergenic
1158992405 18:62882854-62882876 TTAAATAAATTTTATATACTAGG - Intronic
1159128135 18:64248501-64248523 TTGAGTAATTGTTATGTTCTAGG - Intergenic
1162412125 19:10512747-10512769 TTGAAGAAATTTTATTAACTGGG + Exonic
1165126046 19:33598230-33598252 TTAAATAATAGGTATTTACTTGG - Intergenic
1165652114 19:37500598-37500620 TTGATTGACTGTTATTTATTAGG + Intergenic
926079077 2:9969250-9969272 TTGAATGCCTGTTATATGCTAGG + Intronic
926895709 2:17685604-17685626 TTGTATATCTGTGATTTATTTGG - Intronic
928190655 2:29163493-29163515 GTGAAAAACTGTTCTTGACTTGG - Intronic
929395883 2:41521763-41521785 TTGAATACCTGTTGTGTGCTGGG - Intergenic
929500878 2:42490648-42490670 TTGAATATCTGTTATGTTCAAGG - Intronic
929619581 2:43341281-43341303 ATGAATCACTGCAATTTACTGGG - Intronic
930008685 2:46917477-46917499 TTGAATATCTTCTATGTACTAGG + Intronic
930047874 2:47189328-47189350 TTGAATACCTACTATATACTAGG + Intergenic
930145449 2:47998041-47998063 TTGAATAACTTTTATGTGATAGG - Intergenic
930587490 2:53285066-53285088 ATTAATAGATGTTATTTACTGGG - Intergenic
930628962 2:53731539-53731561 TTGAAGAACTGTTTTTTCCATGG - Intronic
930760508 2:55030017-55030039 TTGGTTAACTGTTATTTAGATGG - Intronic
930808375 2:55515896-55515918 GTGAATAATTGTTATTCACAAGG + Intergenic
930990938 2:57653647-57653669 TTGATTAACTGTTAAATCCTTGG - Intergenic
931098661 2:58971056-58971078 TTCAATAAATTTTCTTTACTTGG - Intergenic
932200341 2:69821196-69821218 CTGAATTACTGTTCTTTACCAGG + Intronic
932253343 2:70263415-70263437 TTGAATACCTGTTAGGTGCTAGG + Intronic
933075721 2:77923504-77923526 TGGAATAGCTGTTCTTTATTGGG + Intergenic
933289982 2:80427093-80427115 TTGAATACCTGCTATATGCTAGG - Intronic
933551280 2:83779911-83779933 AAGAATAACTGTCATTTAATTGG + Intergenic
934883383 2:98003579-98003601 TTGAATATCTGCCATTTGCTAGG - Intergenic
937516293 2:122659783-122659805 TTGAACAAGTGTGAATTACTGGG - Intergenic
937681543 2:124649817-124649839 TTGAATACCTATTATGTACCAGG - Intronic
937689861 2:124743300-124743322 TTGAATAACTCTTCTGTATTAGG + Intronic
937702559 2:124880644-124880666 TTGAATACCTATTATATACAAGG + Intronic
939239758 2:139542662-139542684 TTGAATATCTTCTATTTGCTGGG + Intergenic
939681765 2:145144429-145144451 TTGAATAACAGTTCTTTATTAGG - Intergenic
940210746 2:151254234-151254256 CTGAGTACCTGTTATTTACCAGG - Intronic
940453340 2:153868173-153868195 CAGAATGACAGTTATTTACTAGG - Intergenic
940922527 2:159324755-159324777 TTGAATACCTGATATATGCTAGG - Intronic
941480080 2:165996980-165997002 TTGAATATTTGATATTTAATAGG - Intronic
943596892 2:189868963-189868985 TTGAATAATTATTATGTACAGGG + Intronic
944791346 2:203130995-203131017 TTTAATAACTGTTACTTAAGTGG + Intronic
945340187 2:208643385-208643407 TTGAATACCTAGTTTTTACTAGG + Intronic
945379014 2:209116850-209116872 TAAAAAAACTGTTATTTGCTTGG + Intergenic
946054841 2:216891740-216891762 TTGAATATCTGTTATTTGCCAGG - Intergenic
1169759137 20:9072598-9072620 TGGAATAACTTTTATTTGCAAGG + Intronic
1169768069 20:9170359-9170381 TAGATTATCTGTTTTTTACTTGG + Intronic
1169837618 20:9898037-9898059 TTAAATAACTGGTGTTTTCTGGG - Intergenic
1169971069 20:11270125-11270147 TTGACTTACTGGTATCTACTGGG - Intergenic
1169985829 20:11443229-11443251 TTGAATAACTGGAGTTGACTGGG + Intergenic
1170864883 20:20144922-20144944 TTGAATGAAAGATATTTACTGGG - Intronic
1171994129 20:31719240-31719262 TTGAGTACCTGTTAAGTACTAGG - Intronic
1172822569 20:37750751-37750773 GTAGATCACTGTTATTTACTGGG + Intronic
1173056647 20:39620819-39620841 TTGAATAGATGTTGTTTATTAGG - Intergenic
1173312742 20:41914988-41915010 TTGAATACCTATTATTTTCCAGG + Intergenic
1173327184 20:42044633-42044655 GTGAATATCTGTGATTTGCTGGG + Intergenic
1174530135 20:51205308-51205330 TTTAATAACTGCTATTTAATGGG + Intergenic
1176900402 21:14434907-14434929 TTGAAGAAATGTAATTTAGTAGG + Intergenic
1177794310 21:25757124-25757146 TTGAATAGCATTTATTTATTGGG + Intronic
1177945039 21:27456959-27456981 TTGAATAATGGTTGTTTCCTAGG - Intergenic
1177984555 21:27957952-27957974 TTGAATATCTGTTATTTGCTAGG + Intergenic
1179052281 21:37897980-37898002 TTGAATAACAGTCATTTAATAGG - Intronic
1182010501 22:26996775-26996797 TTGAATAACTCCTAGGTACTAGG + Intergenic
1182730162 22:32482771-32482793 TTGAATACCTGCTATGTGCTAGG + Intronic
1183126399 22:35785631-35785653 TTGAAAAGCTGTTATTCATTTGG - Intronic
1183496437 22:38147445-38147467 TTGATTAACAGTTAACTACTGGG + Intronic
1183957745 22:41392048-41392070 TTGAATACCTGTTATATGCCAGG - Intronic
1185025932 22:48412203-48412225 TAGAATAACTGTTATTTTTGTGG + Intergenic
949142233 3:648584-648606 TGAAATAACTGTGATGTACTAGG + Intergenic
949299219 3:2563759-2563781 TTTAATAAGTATTATTTATTTGG - Intronic
950124468 3:10503046-10503068 CTGGATTACTATTATTTACTTGG + Intronic
951114357 3:18842774-18842796 TTGAGTATCTATTATTTGCTTGG + Intergenic
952071246 3:29638802-29638824 TTGAAAAACTGTTATTCTTTAGG + Intronic
952770647 3:36996844-36996866 TTGAGTACCTATTATTTGCTGGG + Intronic
953067890 3:39491403-39491425 ATGAATAAATGTTATGAACTTGG + Intronic
953108713 3:39911401-39911423 TTTAATAACAGTTTTCTACTAGG + Intronic
955247878 3:57245249-57245271 TTGAATACCTATTATGTAATAGG - Intronic
955933738 3:64082729-64082751 TTTTATACCTGTTATTTACCTGG + Intergenic
956235655 3:67068337-67068359 ATAAATAAGTGTTACTTACTTGG + Intergenic
956505201 3:69930387-69930409 CTTAATACATGTTATTTACTTGG - Intronic
956881060 3:73511187-73511209 TTGCTTAATTGTTTTTTACTGGG - Intronic
956934301 3:74082381-74082403 TTTAAAAACAGTTATTTACTTGG - Intergenic
957143432 3:76391056-76391078 TTGAATGCTTGCTATTTACTAGG - Intronic
957315190 3:78567674-78567696 TTAATTTACTGGTATTTACTGGG + Intergenic
957926322 3:86817572-86817594 TTAAATAATATTTATTTACTTGG - Intergenic
958980422 3:100712621-100712643 TTGAATGACTGTTGTCTGCTAGG + Intronic
959298134 3:104564310-104564332 TGGAATAAATGGAATTTACTTGG + Intergenic
959937352 3:112043043-112043065 TTGAATGCCTGCTATATACTGGG + Intronic
960395525 3:117132144-117132166 TTGAGTATCTGTGATTTTCTGGG - Intronic
961157514 3:124692669-124692691 TTGAGTACCTGTTATTTGCCGGG + Intronic
961703607 3:128766328-128766350 TTGAATAACTGTTATTTACTTGG - Intronic
962057102 3:131884173-131884195 TTGAATTCCTATTATTTACCAGG - Intronic
962829585 3:139128381-139128403 TTCAATAACTCTCATTTCCTTGG + Intronic
963765002 3:149325353-149325375 TTGAAGACCTGTTATTTTCTAGG + Intronic
964603512 3:158531047-158531069 TTGAATAACTGAAATTTAAAGGG - Intronic
965212581 3:165812678-165812700 TGGCATAATTGTTATTTACTTGG + Intronic
965529402 3:169756302-169756324 TTGAGCACCTGTTATGTACTAGG + Intergenic
965725798 3:171714258-171714280 ATGAATTACTGTGAATTACTTGG - Intronic
966016946 3:175152038-175152060 TTTAATAGCTGTTATCAACTGGG + Intronic
966575334 3:181494648-181494670 AAGCATAACTGCTATTTACTAGG - Intergenic
966901428 3:184489235-184489257 TTGACAGACTGTTATTTGCTTGG + Intronic
966936614 3:184714083-184714105 ATAAGTAACTGTTATTTCCTAGG - Intergenic
967454547 3:189668563-189668585 TTGGATAACTTCTATTTATTTGG - Intronic
967586494 3:191220736-191220758 TCTAATAAATGTTATTTATTTGG + Intronic
968323158 3:197789441-197789463 TTGGATAAATGTTATTTGCTGGG + Intergenic
970455281 4:16217268-16217290 TTGAGTACCTGTTATGTGCTGGG - Intronic
970626203 4:17886584-17886606 TTGAATAATTAGCATTTACTAGG + Intronic
970901988 4:21170354-21170376 TTGAAGAAATGTTGTTTTCTTGG + Intronic
971026428 4:22593086-22593108 TTGAATATCTGATATTTTGTGGG + Intergenic
971039591 4:22736900-22736922 TTGAATGCCTGTTATTTATGAGG + Intergenic
971087070 4:23291037-23291059 CTGAAAAACAGTTATTTACAGGG + Intergenic
972813770 4:42620986-42621008 TTGAGTACCTTTAATTTACTAGG - Intronic
973566409 4:52193250-52193272 TTGAATATTTGCTATGTACTAGG + Intergenic
974160611 4:58133360-58133382 TTGCATAGCTGTTATTTGATTGG - Intergenic
974570514 4:63641140-63641162 TTTTGTAACTGTTATTTGCTTGG - Intergenic
974655198 4:64810287-64810309 TTAAATAACTGTAAATTAGTGGG - Intergenic
975974861 4:80083325-80083347 TTGAATACCTCTTACTTTCTGGG - Intronic
976236006 4:82897892-82897914 CTTAATAAATGTTTTTTACTTGG + Intronic
976416623 4:84783680-84783702 TTGGATAACTTATGTTTACTTGG - Intronic
977310736 4:95384213-95384235 TTGAATAACTATTACGTGCTAGG + Intronic
977331537 4:95643104-95643126 TTGAACAGCTATTGTTTACTGGG + Intergenic
977392951 4:96436208-96436230 CTGAAAAACTGTTATTTATACGG + Intergenic
977402914 4:96556593-96556615 TTTAAAAACTGTTAGTCACTTGG + Intergenic
977526244 4:98149404-98149426 ATAAATACTTGTTATTTACTGGG - Intergenic
977767180 4:100812840-100812862 TTGAATATCAGCTATGTACTAGG - Intronic
977983103 4:103349224-103349246 TTGAATACCAGTTATGTATTAGG - Intergenic
978123932 4:105112852-105112874 TTTAAAAACTGTAATTTGCTTGG - Intergenic
978228820 4:106373007-106373029 TTGAATATATGTTATTTCTTAGG - Intergenic
978868498 4:113544995-113545017 TTGAATAACTGCTGCTCACTGGG - Intronic
980585076 4:134802548-134802570 TTCAATAAGTGTATTTTACTTGG + Intergenic
980734204 4:136863498-136863520 TTGAATTATTATTATTTTCTAGG + Intergenic
980765096 4:137291831-137291853 ATGAATATCTGTTACTCACTTGG - Intergenic
981057231 4:140375295-140375317 TTGAATACCTACTATGTACTAGG + Intronic
981883268 4:149641777-149641799 TAGCATGACTGTAATTTACTAGG + Intergenic
982682387 4:158446653-158446675 TTCAATAAATTTTATTTATTAGG + Intronic
982695525 4:158595152-158595174 TTGAATAATTAGCATTTACTAGG - Intronic
983107158 4:163701498-163701520 TTGAATAAATGTTTTTTAAAAGG + Intronic
983563949 4:169130160-169130182 TTTAATAACTTTTCTTTTCTCGG - Intronic
984221317 4:176980755-176980777 ATGTATAATTATTATTTACTGGG + Intergenic
985129830 4:186727969-186727991 ATGAATAACTGTTATCTCCCTGG - Intergenic
985243887 4:187959845-187959867 TTGAACACTTGTTATTTTCTGGG + Intergenic
986150275 5:5121917-5121939 TTGAATACCTGTTAGTTGCCTGG - Intergenic
986346180 5:6837443-6837465 TTGTATAACTGTTATTTTTTGGG + Intergenic
987322712 5:16785270-16785292 TTGAATAACTGGCATCTGCTCGG + Intronic
987712487 5:21520266-21520288 TTGCAAATCTGTTATTTAATAGG + Intergenic
988139324 5:27215665-27215687 ATGAGTAACTGTTAATTATTTGG + Intergenic
988234601 5:28525403-28525425 TTGATTAATTGTCATTTTCTAGG + Intergenic
988301936 5:29440529-29440551 TTGAAAATCTGTTATTTAATAGG - Intergenic
988420064 5:30994698-30994720 GTGGATAACTTTTATTTAGTAGG - Intergenic
988866890 5:35345003-35345025 TTCATTAACTGTTATTAATTTGG + Intergenic
989537369 5:42580239-42580261 TTGATGACCTATTATTTACTGGG + Intronic
990782680 5:59383651-59383673 TTGAATAGCTTCTATTTACCAGG - Intronic
990786083 5:59421889-59421911 TTGAATATCTATTATGTACCAGG + Intronic
990937242 5:61163528-61163550 AACAATAACTGTTATTTACCAGG + Intergenic
991311691 5:65250151-65250173 TTGAATACCAGTTAGGTACTAGG + Intronic
991557108 5:67908070-67908092 TTGAGTATCTGTTATGCACTGGG - Intergenic
991762848 5:69939417-69939439 TTGCAAATCTGTTATTTAATAGG + Intergenic
991784480 5:70178708-70178730 TTGCAAATCTGTTATTTAATAGG - Intergenic
991842074 5:70814457-70814479 TTGCAAATCTGTTATTTAATAGG + Intergenic
991876926 5:71179096-71179118 TTGCAAATCTGTTATTTAATAGG - Intergenic
992024295 5:72655339-72655361 ATGGAGAACTGTTATTTAATAGG + Intergenic
992642987 5:78785246-78785268 TTGAATATCTGTTATTCAAAAGG - Intronic
992843033 5:80715228-80715250 TTGAGTACCTGTTTTATACTAGG + Intronic
993162344 5:84308565-84308587 TGGAAGAATTGTTATTTCCTTGG + Intronic
993174223 5:84461544-84461566 TTAAATAACTATTATATACCAGG - Intergenic
993972714 5:94439906-94439928 TTGAATAACATTTTTTTCCTAGG - Intronic
994085159 5:95750451-95750473 TTGAAGAACTGAATTTTACTTGG - Intronic
994858260 5:105154156-105154178 ATAAATAACTTTTATTTGCTTGG + Intergenic
994969999 5:106724224-106724246 TTCAAGCTCTGTTATTTACTTGG - Intergenic
995128002 5:108599276-108599298 TTGAGCAACTGCTATGTACTGGG + Intergenic
995341378 5:111064831-111064853 TGGAATAACTGTTCTTTAAAGGG + Intergenic
995820736 5:116228188-116228210 TACAATAACTGTTATTTATTTGG - Intronic
996160635 5:120158440-120158462 TTGCATAACAGTGATTTTCTGGG - Intergenic
997091889 5:130867936-130867958 TTGAATAACTCTTACATTCTGGG - Intergenic
998336652 5:141377794-141377816 GTAACTATCTGTTATTTACTTGG + Intronic
998579158 5:143352312-143352334 TTTAATAGCTGTTATTTCTTTGG - Intronic
998717736 5:144905469-144905491 TTGACAAACTGTTCTTTATTGGG + Intergenic
1000526134 5:162360184-162360206 TTGAGTACCTATTATTTACCAGG + Intergenic
1000914918 5:167069992-167070014 TTTAACAAATGTTATTTACTAGG - Intergenic
1004292576 6:14381836-14381858 TTGAAAATCTGTTCTGTACTAGG + Intergenic
1004922862 6:20393396-20393418 ATGAAGAACTGCTATTTAATGGG + Intergenic
1008014720 6:46505379-46505401 TTGAATAACAGTTTTTTACCAGG - Intergenic
1008542027 6:52553831-52553853 TTGAATACCTGTGATGTGCTAGG - Intronic
1008734497 6:54526448-54526470 TTGAAAAACTATTAAGTACTAGG + Intergenic
1009294931 6:61934506-61934528 TTGAATAGATGTTATTTATTGGG - Intronic
1009439506 6:63660469-63660491 TTGAATGTCTGTTATATGCTAGG + Intronic
1009776458 6:68211442-68211464 TTGAGTAACTATTATGCACTGGG + Intergenic
1010103635 6:72141884-72141906 TTCAATACCTGTTACTTTCTAGG - Intronic
1010886764 6:81252913-81252935 TTGAGTATCTGTTATGTGCTGGG + Intergenic
1010953734 6:82067511-82067533 TTTAATCACTGATTTTTACTAGG + Intergenic
1010993225 6:82503070-82503092 TTGCATAATTGTTATTTCTTTGG - Intergenic
1011319430 6:86074288-86074310 TTAAATAATTTTTATTTTCTAGG - Intergenic
1011714465 6:90090151-90090173 TTGAATAATTTTTAATAACTTGG - Intronic
1011853981 6:91665430-91665452 TTGAATGCCTATTATGTACTAGG - Intergenic
1011939141 6:92820886-92820908 TTCCATAACTGTCATTTATTTGG + Intergenic
1011978710 6:93342807-93342829 TCTAATAACTGTCATTTAATTGG - Intronic
1012025101 6:93979714-93979736 TTGAATACATGTGGTTTACTTGG + Intergenic
1012077887 6:94716067-94716089 TTGAATATCTCTTTCTTACTGGG - Intergenic
1012337053 6:98073295-98073317 TTTAAAAACTATTATTTACTTGG - Intergenic
1012384431 6:98662476-98662498 TTGAGTACCTATTATGTACTAGG - Intergenic
1012781703 6:103567740-103567762 TTGAATAACCTTTTTTTAATGGG - Intergenic
1012911596 6:105123879-105123901 TTCAATAAATGTCAATTACTTGG + Intronic
1013197089 6:107853917-107853939 ATGAATACCTGTTATTTTCTGGG + Intergenic
1013448381 6:110254284-110254306 TTTAAGAATTGTTATTTATTTGG + Intronic
1013574409 6:111466897-111466919 TTGACTTACTGTTATTTTCTTGG - Intronic
1013799520 6:113925699-113925721 TTGAACATCTATTATATACTAGG - Intergenic
1013847278 6:114468287-114468309 TTAAAAAACTGTTACTTTCTTGG - Intergenic
1014408871 6:121089178-121089200 TTGAATACCTATTATCTACCAGG + Intronic
1014606639 6:123482359-123482381 GTTAATAATTGTTATTTAATAGG + Intronic
1015082261 6:129241448-129241470 TTGAATACATGTTATGTGCTAGG + Intronic
1015089842 6:129342664-129342686 ATTAATAAGTATTATTTACTTGG - Intronic
1015136190 6:129873710-129873732 TTGAATAACTGCTATATACAGGG + Intergenic
1019211382 6:170408097-170408119 TTGAGTAACTGGTAATTACAAGG - Intergenic
1020652450 7:10891903-10891925 TTGAATATCTGTTATATGCTAGG + Intergenic
1021535250 7:21696634-21696656 TTTAATAACTTTTGTTTAATGGG + Intronic
1022071296 7:26917575-26917597 TTGAGTACCTGTTACTTGCTAGG + Intronic
1022434410 7:30367058-30367080 TTTAAAAACTGTAATTTAATTGG + Exonic
1022582778 7:31572892-31572914 TTGAATATCTGTCATGTTCTAGG - Intronic
1023040603 7:36169687-36169709 TGGAATAACTGTTTTGTAATAGG + Intronic
1024176913 7:46849847-46849869 TTTAGTGACTGTTATGTACTAGG + Intergenic
1024617886 7:51130972-51130994 TTGAATAACTGCTATGCACAAGG - Intronic
1024937714 7:54728359-54728381 TTCAATAACTGAGATTGACTGGG + Intergenic
1026472378 7:70704888-70704910 TTAAATAATTGTTAGTTAATTGG - Intronic
1027481429 7:78702577-78702599 TTTTATAACTTTTATTTATTGGG - Intronic
1027673687 7:81133265-81133287 ATCAATACCTGTTATATACTAGG - Intergenic
1027678584 7:81190090-81190112 TCCAATAACTTTCATTTACTTGG - Exonic
1027700759 7:81467737-81467759 TTTAATAACTTTAATTTATTTGG - Intergenic
1027937173 7:84621844-84621866 TTGAATATCAATAATTTACTAGG - Intergenic
1028350666 7:89843253-89843275 TTGAATAACTGTTATTGTGATGG + Intergenic
1028548493 7:92029692-92029714 TTGAATAACAGTATTTTACCAGG - Intronic
1031599137 7:123683827-123683849 TTAAATACTTGTTATTGACTGGG - Exonic
1031693381 7:124818328-124818350 TTTAATAACTTTTATTTAGTAGG + Intergenic
1031737810 7:125388873-125388895 TTGGATAACTATTATTTACTAGG - Intergenic
1031744482 7:125476743-125476765 TTGAATAGCTGTTATATAACTGG + Intergenic
1031961949 7:127998078-127998100 TTGAGTATCTCTTATATACTAGG - Intronic
1033565897 7:142577749-142577771 TTGAATATCTTTAATTTCCTTGG - Intergenic
1034750670 7:153566161-153566183 TTGAATAACATTTTTTTGCTTGG - Intergenic
1036027820 8:4929391-4929413 TTGAATATCTGTTATTTAGGAGG - Intronic
1036114506 8:5944110-5944132 TTGAAGAACTTATATTTACATGG + Intergenic
1036758815 8:11492521-11492543 TTGGACAACTTTTATATACTTGG - Intergenic
1040592567 8:48807078-48807100 TTGGATAACAGTTCTTTACTAGG + Intergenic
1040711119 8:50190088-50190110 CTGAATACCTGCTATATACTAGG + Intronic
1040793603 8:51264181-51264203 TTGGATAACTGTCCTTTATTAGG + Intergenic
1040894706 8:52354080-52354102 TTGAATCACTGTCATATACTTGG + Intronic
1041866300 8:62577970-62577992 TTGAATAGCTTTAATTTCCTTGG - Intronic
1042384248 8:68154277-68154299 TTGAATGAGTTTTATTTACTAGG - Intronic
1042671575 8:71269478-71269500 TTCAATCACTTTTATTCACTGGG + Intronic
1042742721 8:72068815-72068837 TTGAATAGTTCTTATTTACCGGG - Intronic
1043059072 8:75477436-75477458 TTGAAGAACAGTTAATTTCTAGG + Intronic
1043488164 8:80719463-80719485 ACAAATAACTGTTAGTTACTAGG + Intronic
1045853928 8:106740596-106740618 TTGTTTAACTGATAATTACTGGG + Intronic
1046179341 8:110622861-110622883 TTGAATAACAACTATTTAATGGG + Intergenic
1046482959 8:114847287-114847309 TTGAATACATGATATGTACTGGG - Intergenic
1046577904 8:116054729-116054751 TGAAATAACTGTTATTAACTCGG + Intergenic
1047140417 8:122132726-122132748 TTGAATACCTGCTATGTGCTAGG - Intergenic
1047907259 8:129485298-129485320 TTGAGTAACTATTATTTACCTGG - Intergenic
1048284516 8:133131304-133131326 TTGAATAACTCCTATTTGCCAGG + Intronic
1048301917 8:133257846-133257868 TTGACTACCTATTATTTGCTGGG - Intronic
1048514529 8:135093904-135093926 TTGAATCTCTGTTATGTACTAGG + Intergenic
1050120993 9:2307030-2307052 TTGATTTACTGTGATTTACAGGG - Intergenic
1052175719 9:25460350-25460372 TTGTAAAACTATTATTTATTAGG - Intergenic
1052418506 9:28209251-28209273 TTGAATAACTGATATATATGAGG + Intronic
1053533517 9:38904677-38904699 TAGATTAATTGTTATTTACCAGG + Intergenic
1054205742 9:62129106-62129128 TAGATTAATTGTTATTTACCAGG + Intergenic
1054632619 9:67459264-67459286 TAGATTAATTGTTATTTACCAGG - Intergenic
1055113870 9:72586818-72586840 TTGAATTACACTTAGTTACTTGG - Intronic
1056822506 9:89853584-89853606 TTAACTAACAGATATTTACTGGG - Intergenic
1057535781 9:95904365-95904387 TTGAATACCTTCTATTTTCTAGG + Intronic
1057750903 9:97792205-97792227 GTGAATGTGTGTTATTTACTGGG + Intergenic
1058186001 9:101855685-101855707 TTGAACATCTGCTATTTAGTAGG + Intergenic
1060620037 9:125056581-125056603 TTGAATGCCTGTTATGTTCTAGG + Intronic
1061427944 9:130512492-130512514 TTGAATACCTGTTATGGACCAGG - Intergenic
1186968937 X:14819064-14819086 TTGAATTACTATTAGTTAATTGG - Intergenic
1187744355 X:22391870-22391892 TTGCATAATTGCTATTTTCTTGG - Intergenic
1187808103 X:23143373-23143395 TTGAACACCTATTATTTACCAGG - Intergenic
1188255207 X:27954210-27954232 GTGAATAACTGTTCATTGCTTGG + Intergenic
1192264047 X:69526523-69526545 TTTATTAACTGTTGTATACTCGG - Intronic
1193871004 X:86798632-86798654 CTGGATAACTGCTATTCACTGGG + Intronic
1194156188 X:90392320-90392342 TTGTATAACTGTTATTTTAGAGG - Intergenic
1194831649 X:98630843-98630865 TTCAATAAATGGTATTTATTGGG + Intergenic
1195421699 X:104682634-104682656 TTGAGTAGCTATTATTTATTAGG - Intronic
1195643279 X:107201013-107201035 CTCAAAAACTGTTATTTACAAGG + Intronic
1196365779 X:114922084-114922106 TTGAACAACTACTATTTGCTAGG + Intergenic
1200502535 Y:3969289-3969311 TTGTATAACTGTTATTTTAGAGG - Intergenic
1201384323 Y:13421994-13422016 TTGAACTACTGTTGTTTCCTAGG - Intronic
1201645602 Y:16227449-16227471 TTGTATAACTGTAATATACCTGG + Intergenic
1201657211 Y:16357865-16357887 TTGTATAACTGTAATATACCTGG - Intergenic
1201686928 Y:16715196-16715218 TTGAATTCCTGTTATGTACAAGG - Intergenic
1202166282 Y:21992571-21992593 TTGAAAACCTGGTATTTGCTTGG - Intergenic
1202225076 Y:22593802-22593824 TTGAAAACCTGGTATTTGCTTGG + Intergenic
1202318036 Y:23601857-23601879 TTGAAAACCTGGTATTTGCTTGG - Intergenic
1202552730 Y:26068201-26068223 TTGAAAACCTGGTATTTGCTTGG + Intergenic