ID: 961703613

View in Genome Browser
Species Human (GRCh38)
Location 3:128766374-128766396
Sequence GTCCTGGGTAACCACCGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961703607_961703613 23 Left 961703607 3:128766328-128766350 CCAAGTAAATAACAGTTATTCAA 0: 1
1: 0
2: 3
3: 42
4: 406
Right 961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG 0: 1
1: 0
2: 0
3: 1
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961703613 Original CRISPR GTCCTGGGTAACCACCGTCA TGG Intronic
904058398 1:27687133-27687155 GTTCTTGGTTACCACCTTCATGG + Intergenic
904425447 1:30419820-30419842 GACCTGGGCAGCCAACGTCAGGG + Intergenic
913435912 1:118847574-118847596 GTCCTGAGTACCCAGAGTCAAGG + Intergenic
918279814 1:182993407-182993429 CTCCTGTGTAACCACCATCCAGG - Intergenic
919821148 1:201472763-201472785 GTCCTGGGTAGCCACCCAGAGGG - Intergenic
923623789 1:235598007-235598029 GTCTTGGGTAGCCAGAGTCAGGG - Intronic
1071976906 10:90964514-90964536 CTTCTGGGTCACCACAGTCAAGG - Intergenic
1090333273 11:125947259-125947281 CTCCAGGGTCACCATCGTCACGG + Intergenic
1090826545 11:130391192-130391214 GTGCTAGGTAACCACTGTCCCGG + Intergenic
1102246351 12:111358802-111358824 GTTCTGGGTAACCAACTGCAGGG - Intergenic
1103451560 12:121032843-121032865 GGCCTGGGTAACCACAGAAAGGG - Intronic
1109248887 13:59993813-59993835 GTCCTGGGTAATGACTGGCAAGG - Intronic
1121645316 14:95514383-95514405 GTCCTGGCTCACCCCCCTCATGG - Intergenic
1122162177 14:99792986-99793008 GCCCGGGGTAACCTCCGCCACGG - Intronic
1122410493 14:101523231-101523253 GCCCTGTGGAAGCACCGTCAAGG - Intergenic
1122854324 14:104552913-104552935 GCCCTGGGTAACCTCCCTCTGGG + Intronic
1123019902 14:105392810-105392832 CTCCTTGGTGACCACGGTCATGG - Exonic
1123061870 14:105598135-105598157 GACCTGGGTGCCCACCCTCAGGG - Intergenic
1123086610 14:105719866-105719888 GACCTGGGTGCCCACCCTCAGGG - Intergenic
1137341694 16:47613671-47613693 ATTTTGTGTAACCACCGTCACGG + Intronic
1146023068 17:29295115-29295137 TTCCTGAGTAACCACTATCATGG - Intergenic
1152325186 17:79631887-79631909 CTGCTGGGTACCCTCCGTCAGGG - Intergenic
1162440667 19:10690240-10690262 GGCCTGGGTAACCCCAGCCATGG + Exonic
1162934109 19:13972653-13972675 GTGGTTGGTAACCACCGTCATGG + Intronic
1165726963 19:38119629-38119651 GTCCTGGGCCACCACCCTCCAGG - Exonic
1166390989 19:42408860-42408882 GACCTGGGTAGCGACAGTCAGGG + Intronic
1166502265 19:43350683-43350705 GTCCTGCGTAACCACAGACCAGG - Intergenic
926857259 2:17270670-17270692 GGCCAGGGTAAACACAGTCATGG + Intergenic
930946902 2:57085299-57085321 GTCCAGAGCAACCACTGTCATGG - Intergenic
936032220 2:109081594-109081616 GTCCTGGGGAACCAACCCCATGG + Intergenic
940498913 2:154469912-154469934 GACCTGGGTAAGCACCTTGATGG - Intergenic
1169350591 20:4865068-4865090 GTCCTGGGGAAGCACCGGGAAGG - Intronic
1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG + Intronic
1179972357 21:44843199-44843221 GCCCTGGGTAGCCACCTCCACGG + Intergenic
951855902 3:27196618-27196640 GTCCTGGGTAGCCATAGCCAGGG + Intronic
951930543 3:27962203-27962225 GTCCTGGTTAAGCACACTCATGG + Intergenic
953688471 3:45096827-45096849 CTCTGGGGTAACCACAGTCACGG - Intronic
954628608 3:52036226-52036248 GCCCTGGGGATGCACCGTCAGGG - Intergenic
954795647 3:53160322-53160344 GTCCTGGGGAACCACCTAGAAGG - Intronic
957214236 3:77298571-77298593 GTCATGGGAAACCACCATTAAGG + Intronic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
962385833 3:134931536-134931558 GTCCTCTGGAACCACCTTCAGGG + Intronic
1004381340 6:15135209-15135231 GTCCTTGGTTACCACCCTCCCGG + Intergenic
1006053968 6:31367025-31367047 GTCCTGGGCATCCACCTCCAGGG + Intergenic
1012292260 6:97471469-97471491 GTCCAGGGTAAGTACTGTCAGGG - Intergenic
1015985138 6:138877008-138877030 GTCCTGTGTAACCCACGGCATGG + Intronic
1016977975 6:149827708-149827730 GTCCTTGGTGACCACTGTCGTGG - Intronic
1017748067 6:157464924-157464946 GTCTTGGGTAACCAGCCTCTAGG + Intronic
1024438968 7:49392953-49392975 GTCCTGGGTAACCCACTTAAAGG - Intergenic
1046747201 8:117888991-117889013 CTCCTGGTGAACCACCATCAGGG - Intronic
1048991291 8:139761691-139761713 GTGCTGGGTCACCCCCCTCAGGG + Intronic
1049438068 8:142596830-142596852 GTCCTGGCCACCCACTGTCAAGG - Intergenic
1052437915 9:28453761-28453783 CTCCTTGGCAACCACCTTCAGGG + Intronic
1059363672 9:113768395-113768417 TGCCAGGGTAACCACAGTCAAGG + Intergenic
1187571182 X:20504204-20504226 GTCCTGAATAACCACCATCTTGG - Intergenic
1188187577 X:27133523-27133545 GTCCTGGGTAACCAGACACATGG - Intergenic