ID: 961706961

View in Genome Browser
Species Human (GRCh38)
Location 3:128794476-128794498
Sequence CTGACAGCAGTGCCTATAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961706961_961706963 -7 Left 961706961 3:128794476-128794498 CCCACTATAGGCACTGCTGTCAG 0: 1
1: 0
2: 2
3: 12
4: 89
Right 961706963 3:128794492-128794514 CTGTCAGCCTTGCCTTCAAAAGG 0: 1
1: 0
2: 2
3: 14
4: 175
961706961_961706964 -3 Left 961706961 3:128794476-128794498 CCCACTATAGGCACTGCTGTCAG 0: 1
1: 0
2: 2
3: 12
4: 89
Right 961706964 3:128794496-128794518 CAGCCTTGCCTTCAAAAGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 150
961706961_961706966 0 Left 961706961 3:128794476-128794498 CCCACTATAGGCACTGCTGTCAG 0: 1
1: 0
2: 2
3: 12
4: 89
Right 961706966 3:128794499-128794521 CCTTGCCTTCAAAAGGTAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 121
961706961_961706968 9 Left 961706961 3:128794476-128794498 CCCACTATAGGCACTGCTGTCAG 0: 1
1: 0
2: 2
3: 12
4: 89
Right 961706968 3:128794508-128794530 CAAAAGGTAGGTGGTTAAAGAGG 0: 1
1: 0
2: 0
3: 9
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961706961 Original CRISPR CTGACAGCAGTGCCTATAGT GGG (reversed) Intronic
903887806 1:26551167-26551189 CTCACAGCAGTGCCCACAGCTGG - Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
908706216 1:66958189-66958211 ATGACAACAGTGGCTGTAGTGGG + Exonic
908776443 1:67645617-67645639 CTGACCACAGTGCCTATAGTTGG + Intergenic
909768965 1:79396198-79396220 CTAAAAGCAGTGCCTAGACTTGG + Intergenic
912645876 1:111391322-111391344 CTGAGAGCATTGCTTATAGAGGG - Intergenic
916424848 1:164670494-164670516 GTAGCAGCAGTGCCTATAGGTGG - Intronic
1065865352 10:29910349-29910371 ATGACAGCAGTGCCAGGAGTTGG - Intergenic
1066413741 10:35199497-35199519 TTGACAGCACTTTCTATAGTTGG - Intronic
1066653079 10:37678281-37678303 CTGCAACCAGTGCTTATAGTGGG + Intergenic
1067037429 10:42930811-42930833 CTGCAACCAGTGCTTATAGTGGG + Intergenic
1070138706 10:73719757-73719779 CTGGCAGCAGTGCCCATGCTGGG + Intergenic
1071240635 10:83701085-83701107 CTGGCAGCTGTGCCCATAGAAGG + Intergenic
1073096076 10:100980526-100980548 CTGAGAGCAGATCCCATAGTTGG + Intronic
1073636488 10:105204026-105204048 CTGACAGCACTCCCTAAAGAAGG - Intronic
1079658740 11:23015640-23015662 CTGAAAGCAGTGCTTTTATTGGG + Intergenic
1080663976 11:34319492-34319514 CAGACAGCACTGCATATACTTGG - Intronic
1081184578 11:40026343-40026365 TTGACACCAGTGGCTATTGTGGG - Intergenic
1081968402 11:47183135-47183157 CTGACAGCAGTTGCTATATTGGG - Intronic
1082099388 11:48159493-48159515 CTGAAAGCAGGGCCTGTTGTAGG + Intronic
1090896311 11:130978790-130978812 ATGACAGCAGTGTGTATAGCAGG + Intergenic
1096019297 12:48308797-48308819 ATAACAGCAATGCCTACAGTTGG - Intergenic
1097497517 12:60359201-60359223 CTTAGAGCACAGCCTATAGTGGG + Intergenic
1100059726 12:90559751-90559773 CTGACAGCAGTGAATAAAATAGG + Intergenic
1101235268 12:102782151-102782173 CTGACTGCAGTGAATTTAGTAGG - Intergenic
1102946678 12:116995508-116995530 CTAACAGCTGTGCCTATTGCTGG + Intronic
1111427786 13:88111148-88111170 CAGACAGCAAAGCATATAGTTGG + Intergenic
1112135685 13:96575351-96575373 CTGGTAGCAGTGCCTATAGTTGG + Intronic
1116951147 14:50879775-50879797 CAGGCAGCAGTGCCTATATTCGG + Intronic
1118497689 14:66325129-66325151 CTGCAAGCAGTTACTATAGTAGG + Intergenic
1118947166 14:70398903-70398925 CTCACAGCCCTGCCTATAGGGGG + Intronic
1120546037 14:85812611-85812633 CTGAAAGCAGTGCCTACATCTGG - Intergenic
1121052557 14:90828962-90828984 CTGACAGCACTGTCTATTCTAGG + Intergenic
1122284301 14:100641773-100641795 CTGACAGCGCTGCCTTTATTTGG + Intergenic
1126325797 15:47475956-47475978 CTGAATGGAGGGCCTATAGTGGG + Intronic
1128352048 15:66897599-66897621 GTGTCAGGAGTGCCTTTAGTCGG + Intergenic
1128411232 15:67400417-67400439 CTGCCAGCAGTGCCTTTCTTGGG + Intronic
1129154115 15:73707090-73707112 TTGCCAGCAGTGCCTATTGAAGG + Intronic
1129617379 15:77109579-77109601 CTTACAGCAGTGCCAAAAGTGGG - Exonic
1130869289 15:87957655-87957677 CTTACAGAAGTGACTACAGTTGG - Intronic
1130983279 15:88827615-88827637 CTGACCTCAGTGCCCATAGTAGG + Intronic
1131540877 15:93274331-93274353 CTGACTGCAGAGCCCATTGTTGG - Intergenic
1133784156 16:8962701-8962723 CTAACAGCACTGCCTAGCGTCGG - Intronic
1137023466 16:35452256-35452278 CTGACATGACTGCCTCTAGTTGG - Intergenic
1141283696 16:82651766-82651788 CTTACAGCAGTGCCTTCAATAGG + Intronic
1150690511 17:67362714-67362736 CTGGCTGCAGAGCCTGTAGTGGG - Intronic
1160287317 18:77556415-77556437 GTGACACCAGTGCCTATTGTGGG + Intergenic
925361322 2:3282547-3282569 CTGACATCGGTGCCTACAGACGG + Intronic
927642333 2:24853104-24853126 CTGGAGGCAGTGCCTTTAGTAGG - Intronic
935395882 2:102608160-102608182 CTGACAGCGCTGTCTAAAGTAGG + Intergenic
935454572 2:103252344-103252366 CTGAAAGCAGTGTATAAAGTTGG - Intergenic
935956848 2:108385515-108385537 CTGACCACTGTGTCTATAGTGGG - Intronic
938015546 2:127864216-127864238 CTGGTAGCAGTGCCTATAGCTGG - Exonic
939492112 2:142888791-142888813 CTGACAGAAGTGTCTCGAGTAGG - Intronic
941240392 2:163028947-163028969 CAGACAGCAGAGCCAAGAGTTGG + Intergenic
942810350 2:179992036-179992058 TTGACAGCAGGCCCTGTAGTAGG - Intronic
943593750 2:189830649-189830671 CTTACAGTAGTGCCTCAAGTGGG + Intronic
1173221006 20:41133206-41133228 CTGACAGCTCTCCCAATAGTTGG - Intergenic
1183085982 22:35487418-35487440 CTCACAGCGGTGCCTCGAGTGGG + Intergenic
949692578 3:6656723-6656745 CTTAGAGCAATGGCTATAGTTGG - Intergenic
950498013 3:13345909-13345931 CTGACAGCAGTAACTACAGTAGG - Intronic
958900078 3:99876024-99876046 CTGACAGCAGTGCCCCTTGGTGG + Intronic
961706961 3:128794476-128794498 CTGACAGCAGTGCCTATAGTGGG - Intronic
962288094 3:134105478-134105500 ATCATAGCAGTGGCTATAGTGGG + Intronic
962484603 3:135830348-135830370 CTGGCAGCAGTGCTGATGGTTGG - Intergenic
962626516 3:137230963-137230985 CTGACCTCAGAGCCTAGAGTGGG + Intergenic
962736194 3:138327673-138327695 TTGAAAGCAATGCCTAAAGTTGG - Intronic
963271995 3:143294355-143294377 CTGACAGCAACACCTTTAGTAGG + Intronic
966243102 3:177776438-177776460 CTGATAGCAGAGCCAAGAGTTGG + Intergenic
968895952 4:3403471-3403493 CTGACATCAGTGACTATGCTGGG - Intronic
974710644 4:65589463-65589485 CTGACAGCAGTGGCTTTCTTTGG - Intronic
976103585 4:81592400-81592422 CTGCCTGCTGTGCCTTTAGTAGG - Intronic
976783005 4:88782841-88782863 CTGAGAGCAGTGCCTTCTGTGGG + Intronic
977628424 4:99214823-99214845 CTGACAGCACTTTCTACAGTTGG - Intronic
981903924 4:149897426-149897448 CTGAGTTCAGTGCTTATAGTGGG - Intergenic
982238855 4:153278476-153278498 TTTACACCAGTGTCTATAGTAGG + Intronic
983075202 4:163317209-163317231 CAGAAAGCAGTGTCTAGAGTTGG + Intergenic
983982933 4:174021685-174021707 CTGGGACCAGTGCCTATTGTTGG + Intergenic
986525067 5:8664793-8664815 GTGACAGCAGTCCCTATTGTTGG - Intergenic
986771069 5:10974162-10974184 CTCTCTGCAGTGCCTATATTAGG - Intronic
988782179 5:34532394-34532416 CTCTCAGCAGTGCCTATAACTGG - Intergenic
998144119 5:139716576-139716598 CTGATAGGAGTGCCTAGAGGGGG + Intergenic
1005495061 6:26381240-26381262 CTGAGAGCAGAGCTTAGAGTTGG + Intergenic
1006387694 6:33740548-33740570 CTGACAGCAGGGCCGTGAGTGGG + Intronic
1015548244 6:134384651-134384673 CTGACATCAGTGCCTTTTTTGGG + Intergenic
1016183128 6:141171332-141171354 CTGACATCAGAGACTATGGTTGG - Intergenic
1016466816 6:144334126-144334148 CTGACATCATTGCCTAATGTTGG + Intronic
1020839687 7:13200020-13200042 CTGACAGTATTGCCAATACTGGG - Intergenic
1023078242 7:36504042-36504064 CTGACACCTGTGTCTTTAGTCGG + Intergenic
1027427703 7:78078293-78078315 CTGTCAGTAGTGTCTATAATGGG + Intronic
1034270298 7:149800413-149800435 CTCACCGCAGTGCCTCTCGTCGG - Intergenic
1047286737 8:123493736-123493758 ATGAGAGCAGTGCCTATAATCGG - Intergenic
1047351772 8:124080933-124080955 CTGACAGAAGTGGCTGTAGCAGG - Intronic
1049312815 8:141942515-141942537 ATGACAGCATTGCCATTAGTGGG + Intergenic
1051997643 9:23237886-23237908 CTGACAGCAGAGGCTACAGTTGG - Intergenic
1053057127 9:34999919-34999941 CAGACAGCACTGCCTTTAGCTGG + Intergenic
1056772625 9:89491111-89491133 AGGACAGCATTGCCTCTAGTGGG + Intronic
1057078997 9:92158363-92158385 CTGACAGTGGTGGCTGTAGTCGG + Intergenic
1061008502 9:127942014-127942036 CTGAGAGCAGAGGCTTTAGTAGG + Exonic
1191879685 X:65832890-65832912 CTGAAAGCAGTGCCAATGATGGG + Intergenic
1193350465 X:80457729-80457751 CTGTTAGCAGTGCCTATAGCTGG - Intergenic
1196787079 X:119430346-119430368 TTGACAGCAGTTCTTAAAGTTGG + Intronic
1200376830 X:155790551-155790573 CTAACAGCAGTGCCTTTAGAGGG + Intergenic
1201551912 Y:15226616-15226638 CACACACCAGGGCCTATAGTGGG + Intergenic