ID: 961712024

View in Genome Browser
Species Human (GRCh38)
Location 3:128835127-128835149
Sequence CCCACAGGGTACCCGAGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961712024_961712032 -8 Left 961712024 3:128835127-128835149 CCCGACCTCGGGTACCCTGTGGG No data
Right 961712032 3:128835142-128835164 CCTGTGGGTGGTGTTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961712024 Original CRISPR CCCACAGGGTACCCGAGGTC GGG (reversed) Intergenic
No off target data available for this crispr