ID: 961714250

View in Genome Browser
Species Human (GRCh38)
Location 3:128847818-128847840
Sequence TGCCACTGGGCTGGGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961714242_961714250 13 Left 961714242 3:128847782-128847804 CCGGCAGCAACTTGGACACCTCC No data
Right 961714250 3:128847818-128847840 TGCCACTGGGCTGGGTGTGCTGG No data
961714244_961714250 -8 Left 961714244 3:128847803-128847825 CCATCCTCTGCTGAATGCCACTG No data
Right 961714250 3:128847818-128847840 TGCCACTGGGCTGGGTGTGCTGG No data
961714241_961714250 14 Left 961714241 3:128847781-128847803 CCCGGCAGCAACTTGGACACCTC No data
Right 961714250 3:128847818-128847840 TGCCACTGGGCTGGGTGTGCTGG No data
961714243_961714250 -5 Left 961714243 3:128847800-128847822 CCTCCATCCTCTGCTGAATGCCA No data
Right 961714250 3:128847818-128847840 TGCCACTGGGCTGGGTGTGCTGG No data
961714240_961714250 15 Left 961714240 3:128847780-128847802 CCCCGGCAGCAACTTGGACACCT No data
Right 961714250 3:128847818-128847840 TGCCACTGGGCTGGGTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961714250 Original CRISPR TGCCACTGGGCTGGGTGTGC TGG Intergenic
No off target data available for this crispr