ID: 961714649

View in Genome Browser
Species Human (GRCh38)
Location 3:128850046-128850068
Sequence GAGGCACTCGACCTGCCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961714649_961714659 27 Left 961714649 3:128850046-128850068 CCCGTGGGCAGGTCGAGTGCCTC No data
Right 961714659 3:128850096-128850118 AGCTCCCGGCCATGGCCTCCCGG No data
961714649_961714660 28 Left 961714649 3:128850046-128850068 CCCGTGGGCAGGTCGAGTGCCTC No data
Right 961714660 3:128850097-128850119 GCTCCCGGCCATGGCCTCCCGGG No data
961714649_961714656 19 Left 961714649 3:128850046-128850068 CCCGTGGGCAGGTCGAGTGCCTC No data
Right 961714656 3:128850088-128850110 GCCCACAAAGCTCCCGGCCATGG No data
961714649_961714662 30 Left 961714649 3:128850046-128850068 CCCGTGGGCAGGTCGAGTGCCTC No data
Right 961714662 3:128850099-128850121 TCCCGGCCATGGCCTCCCGGGGG No data
961714649_961714655 13 Left 961714649 3:128850046-128850068 CCCGTGGGCAGGTCGAGTGCCTC No data
Right 961714655 3:128850082-128850104 GCTGCTGCCCACAAAGCTCCCGG No data
961714649_961714652 -9 Left 961714649 3:128850046-128850068 CCCGTGGGCAGGTCGAGTGCCTC No data
Right 961714652 3:128850060-128850082 GAGTGCCTCTGGCACTCCGTTGG No data
961714649_961714661 29 Left 961714649 3:128850046-128850068 CCCGTGGGCAGGTCGAGTGCCTC No data
Right 961714661 3:128850098-128850120 CTCCCGGCCATGGCCTCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961714649 Original CRISPR GAGGCACTCGACCTGCCCAC GGG (reversed) Intergenic
No off target data available for this crispr